EMAIL THIS PAGE TO A FRIEND

MAP3K7

mitogen-activated protein kinase kinase kinase 7

195 Gene Product Result for
Synonyms: MEKK7 TAK1 TGF1a
Gene ID:
Human(6885) Summary: The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase mediates the signaling transduction induced by TGF beta and morphogenetic protein (BMP), and controls a variety of cell functions including transcription regulation and apoptosis. In response to IL-1, this protein forms a kinase complex including TRAF6, MAP3K7P1/TAB1 and MAP3K7P2/TAB2; this complex is required for the activation of nuclear factor kappa B. This kinase can also activate MAPK8/JNK, MAP2K4/MKK4, and thus plays a role in the cell response to environmental stresses. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(26409) mitogen-activated protein kinase kinase kinase 7
Rat(313121) mitogen activated protein kinase kinase kinase 7
Domestic Rabbit(100343571) mitogen-activated protein kinase kinase kinase 7
naked mole-rat(101718269) mitogen-activated protein kinase kinase kinase 7
domestic guinea pig(100718100) mitogen-activated protein kinase kinase kinase 7
sheep(101108056) mitogen-activated protein kinase kinase kinase 7
sheep(100294587) mitogen-activated protein kinase kinase kinase 7
Zebrafish(553788) mitogen activated protein kinase kinase kinase 7
cow(529146) mitogen-activated protein kinase kinase kinase 7
Horse(100065841) mitogen-activated protein kinase kinase kinase 7
domestic cat(101095899) mitogen-activated protein kinase kinase kinase 7
dog(474996) mitogen-activated protein kinase kinase kinase 7
chicken(421808) mitogen-activated protein kinase kinase kinase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M9071 Anti-MAP3K7 (446-460) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406506 Anti-MAP3K7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2702467 Anti-Map3k7 antibody produced in rabbit affinity isolated antibody zebrafish
immunohistochemistry pricing
HPA007633 Anti-MAP3K7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4502923 Anti-MAP3K7 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1304644 ANTI-MOUSE MAP3K7 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB4504619 Anti-phospho-MAP3K7 (pSer439) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504618 Anti-phospho-MAP3K7 (pThr187) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301400 Anti-phospho-MAP3K7 (pThr187) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504268 Anti-phospho-TAK1 (pThr184) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
T7824 Anti-TAK1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunoprecipitation (IP), western blot pricing
SAB3500369 Anti-TAK1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB4502922 Anti-TAK1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB1305414 ANTI-TAK1(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2501016 Anti-TAK1/MAP3K7 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
WH0006885M2 Monoclonal Anti-MAP3K7 antibody produced in mouse clone 2E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404440 Monoclonal Anti-MAP3K7, (C-terminal) antibody produced in mouse clone 3C9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145332 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003188 Rosetta Predictions human pricing
NM_145331 Rosetta Predictions human pricing
NM_145332 Rosetta Predictions human pricing
NM_145333 Rosetta Predictions human pricing
NM_001107920 Rosetta Predictions rat pricing
NM_172688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335227 predicted 697
2 SASI_Hs01_00234777 predicted 764
3 SASI_Hs01_00234778 predicted 734
4 SASI_Hs01_00234779 predicted 1176
5 SASI_Hs01_00234780 predicted 850
6 SASI_Hs01_00234781 predicted 1185
7 SASI_Hs01_00234784 predicted 1088
8 SASI_Hs02_00335228 predicted 727
9 SASI_Hs02_00335229 predicted 1275
10 SASI_Hs01_00234785 predicted 550
11 SASI_Hs01_00234776 predicted 566
12 SASI_Hs01_00234782 predicted 569
13 SASI_Hs01_00234783 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365227 predicted 560
2 SASI_Hs01_00166578 predicted 621
3 SASI_Hs01_00166579 predicted 594
4 SASI_Hs01_00166580 predicted 1041
5 SASI_Hs01_00166581 predicted 712
6 SASI_Hs01_00166582 predicted 1047
7 SASI_Hs01_00166585 predicted 936
8 SASI_Hs02_00365228 predicted 584
9 SASI_Hs02_00365229 predicted 1126
10 SASI_Hs01_00166586 predicted 406
11 SASI_Hs01_00166577 predicted 417
12 SASI_Hs01_00166583 predicted 423
13 SASI_Hs01_00166584 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365230 predicted 695
2 SASI_Hs01_00046419 predicted 770
3 SASI_Hs01_00046420 predicted 741
4 SASI_Hs01_00046421 predicted 1185
5 SASI_Hs01_00046422 predicted 850
6 SASI_Hs01_00046423 predicted 1192
7 SASI_Hs01_00046426 predicted 1086
8 SASI_Hs02_00365231 predicted 728
9 SASI_Hs02_00365232 predicted 1269
10 SASI_Hs01_00046427 predicted 545
11 SASI_Hs01_00046418 predicted 561
12 SASI_Hs01_00046424 predicted 570
13 SASI_Hs01_00046425 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365233 predicted 694
2 SASI_Hs01_00171960 predicted 763
3 SASI_Hs01_00171961 predicted 742
4 SASI_Hs01_00171962 predicted 1176
5 SASI_Hs01_00171963 predicted 852
6 SASI_Hs01_00171964 predicted 1183
7 SASI_Hs01_00171967 predicted 1084
8 SASI_Hs02_00365234 predicted 721
9 SASI_Hs02_00365235 predicted 1270
10 SASI_Hs01_00171968 predicted 550
11 SASI_Hs01_00171959 predicted 560
12 SASI_Hs01_00171965 predicted 569
13 SASI_Hs01_00171966 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233585 predicted 1917
2 SASI_Rn02_00233586 predicted 1904
3 SASI_Rn02_00233587 predicted 887
4 SASI_Rn02_00233588 predicted 1506
5 SASI_Rn02_00233589 predicted 1776
6 SASI_Rn02_00233590 predicted 562
7 SASI_Rn02_00233591 predicted 1903
8 SASI_Rn02_00233592 predicted 1685
9 SASI_Rn02_00233593 predicted 677
10 SASI_Rn02_00233594 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200045 predicted 1930
2 SASI_Mm02_00344430 predicted 1097
3 SASI_Mm01_00200046 predicted 392
4 SASI_Mm02_00344431 predicted 1034
5 SASI_Mm01_00200048 predicted 1798
6 SASI_Mm01_00200049 predicted 498
7 SASI_Mm01_00200050 predicted 1533
8 SASI_Mm01_00200051 predicted 736
9 SASI_Mm01_00200052 predicted 1926
10 SASI_Mm01_00200053 predicted 994
11 SASI_Mm01_00200047 predicted 320
12 SASI_Mm01_00200054 predicted 1711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172688
VALIDATED
MAP3K7 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-961s21c1
Sequence:CCGGCGCCCTTCAATGGAGGAAATTCTCGAGAATTTCCTCCATTGAAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-730s21c1
Sequence:CCGGGCGCCTGAAGTATTTGAAGGTCTCGAGACCTTCAAATACTTCAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-1208s21c1
Sequence:CCGGAGGCAAAGCAACAGAGTGAATCTCGAGATTCACTCTGTTGCTTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-962s1c1
Sequence:CCGGCGCCCTTCAATGGAGGAAATTCTCGAGAATTTCCTCCATTGAAGGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172688.1-1435s1c1
Sequence:CCGGCAGCCCTAGTGTCAGAATGATCTCGAGATCATTCTGACACTAGGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-731s1c1
Sequence:CCGGGCGCCTGAAGTATTTGAAGGTCTCGAGACCTTCAAATACTTCAGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-347s1c1
Sequence:CCGGTCTGAGAGGAAGGCTTTCATTCTCGAGAATGAAAGCCTTCCTCTCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-346s21c1
Sequence:CCGGTCTGAGAGGAAGGCTTTCATTCTCGAGAATGAAAGCCTTCCTCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-1209s1c1
Sequence:CCGGAGGCAAAGCAACAGAGTGAATCTCGAGATTCACTCTGTTGCTTTGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172688.2-1928s21c1
Sequence:CCGGAGAGAAGACAAACCATTATAACTCGAGTTATAATGGTTTGTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172688
VALIDATED
MAP3K7 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-961s21c1
Sequence:CCGGCGCCCTTCAATGGAGGAAATTCTCGAGAATTTCCTCCATTGAAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-730s21c1
Sequence:CCGGGCGCCTGAAGTATTTGAAGGTCTCGAGACCTTCAAATACTTCAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-1208s21c1
Sequence:CCGGAGGCAAAGCAACAGAGTGAATCTCGAGATTCACTCTGTTGCTTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-962s1c1
Sequence:CCGGCGCCCTTCAATGGAGGAAATTCTCGAGAATTTCCTCCATTGAAGGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172688.1-1435s1c1
Sequence:CCGGCAGCCCTAGTGTCAGAATGATCTCGAGATCATTCTGACACTAGGGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-731s1c1
Sequence:CCGGGCGCCTGAAGTATTTGAAGGTCTCGAGACCTTCAAATACTTCAGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-347s1c1
Sequence:CCGGTCTGAGAGGAAGGCTTTCATTCTCGAGAATGAAAGCCTTCCTCTCAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-346s21c1
Sequence:CCGGTCTGAGAGGAAGGCTTTCATTCTCGAGAATGAAAGCCTTCCTCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-1209s1c1
Sequence:CCGGAGGCAAAGCAACAGAGTGAATCTCGAGATTCACTCTGTTGCTTTGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172688.2-1928s21c1
Sequence:CCGGAGAGAAGACAAACCATTATAACTCGAGTTATAATGGTTTGTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172688
VALIDATED
MAP3K7 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-961s21c1
Sequence:CCGGCGCCCTTCAATGGAGGAAATTCTCGAGAATTTCCTCCATTGAAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-730s21c1
Sequence:CCGGGCGCCTGAAGTATTTGAAGGTCTCGAGACCTTCAAATACTTCAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-1208s21c1
Sequence:CCGGAGGCAAAGCAACAGAGTGAATCTCGAGATTCACTCTGTTGCTTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-962s1c1
Sequence:CCGGCGCCCTTCAATGGAGGAAATTCTCGAGAATTTCCTCCATTGAAGGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172688.1-1435s1c1
Sequence:CCGGCAGCCCTAGTGTCAGAATGATCTCGAGATCATTCTGACACTAGGGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-731s1c1
Sequence:CCGGGCGCCTGAAGTATTTGAAGGTCTCGAGACCTTCAAATACTTCAGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-347s1c1
Sequence:CCGGTCTGAGAGGAAGGCTTTCATTCTCGAGAATGAAAGCCTTCCTCTCAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172688.2-346s21c1
Sequence:CCGGTCTGAGAGGAAGGCTTTCATTCTCGAGAATGAAAGCCTTCCTCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172688.1-1209s1c1
Sequence:CCGGAGGCAAAGCAACAGAGTGAATCTCGAGATTCACTCTGTTGCTTTGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172688.2-1928s21c1
Sequence:CCGGAGAGAAGACAAACCATTATAACTCGAGTTATAATGGTTTGTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145332
VALIDATED
MAP3K7 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.1-1272s1c1
Sequence:CCGGGCTTCTACAAATACGAGTAACCTCGAGGTTACTCGTATTTGTAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.1-1790s1c1
Sequence:CCGGCATCCCAATGGCTTATCTTACCTCGAGGTAAGATAAGCCATTGGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.1-2512s1c1
Sequence:CCGGCGGAACCTTTAGGGATAGTTCCTCGAGGAACTATCCCTAAAGGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145332.1-1621s1c1
Sequence:CCGGCCATCCAAGACTTGACTGTAACTCGAGTTACAGTCAAGTCTTGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.x-2844s1c1
Sequence:CCGGGCAGTGATTCTTGGATTGTTTCTCGAGAAACAATCCAAGAATCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.x-601s1c1
Sequence:CCGGCAGTGTGTCTTGTGATGGAATCTCGAGATTCCATCACAAGACACACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.x-854s1c1
Sequence:CCGGGACACACATGACCAATAACAACTCGAGTTGTTATTGGTCATGTGTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.x-1319s1c1
Sequence:CCGGTCCTGCCACAAATGATACTATCTCGAGATAGTATCATTTGTGGCAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.x-550s1c1
Sequence:CCGGCCCGTGTGAACCATCCTAATACTCGAGTATTAGGATGGTTCACACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.1-981s1c1
Sequence:CCGGCGGAAACCCTTTGATGAGATTCTCGAGAATCTCATCAAAGGGTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145332
VALIDATED
MAP3K7 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.1-1272s1c1
Sequence:CCGGGCTTCTACAAATACGAGTAACCTCGAGGTTACTCGTATTTGTAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.1-1790s1c1
Sequence:CCGGCATCCCAATGGCTTATCTTACCTCGAGGTAAGATAAGCCATTGGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.1-2512s1c1
Sequence:CCGGCGGAACCTTTAGGGATAGTTCCTCGAGGAACTATCCCTAAAGGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145332.1-1621s1c1
Sequence:CCGGCCATCCAAGACTTGACTGTAACTCGAGTTACAGTCAAGTCTTGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.x-2844s1c1
Sequence:CCGGGCAGTGATTCTTGGATTGTTTCTCGAGAAACAATCCAAGAATCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.x-601s1c1
Sequence:CCGGCAGTGTGTCTTGTGATGGAATCTCGAGATTCCATCACAAGACACACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.x-854s1c1
Sequence:CCGGGACACACATGACCAATAACAACTCGAGTTGTTATTGGTCATGTGTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.x-1319s1c1
Sequence:CCGGTCCTGCCACAAATGATACTATCTCGAGATAGTATCATTTGTGGCAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.x-550s1c1
Sequence:CCGGCCCGTGTGAACCATCCTAATACTCGAGTATTAGGATGGTTCACACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.1-981s1c1
Sequence:CCGGCGGAAACCCTTTGATGAGATTCTCGAGAATCTCATCAAAGGGTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145332
VALIDATED
MAP3K7 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.1-1272s1c1
Sequence:CCGGGCTTCTACAAATACGAGTAACCTCGAGGTTACTCGTATTTGTAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.1-1790s1c1
Sequence:CCGGCATCCCAATGGCTTATCTTACCTCGAGGTAAGATAAGCCATTGGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.1-2512s1c1
Sequence:CCGGCGGAACCTTTAGGGATAGTTCCTCGAGGAACTATCCCTAAAGGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145332.1-1621s1c1
Sequence:CCGGCCATCCAAGACTTGACTGTAACTCGAGTTACAGTCAAGTCTTGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.x-2844s1c1
Sequence:CCGGGCAGTGATTCTTGGATTGTTTCTCGAGAAACAATCCAAGAATCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.x-601s1c1
Sequence:CCGGCAGTGTGTCTTGTGATGGAATCTCGAGATTCCATCACAAGACACACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.x-854s1c1
Sequence:CCGGGACACACATGACCAATAACAACTCGAGTTGTTATTGGTCATGTGTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.x-1319s1c1
Sequence:CCGGTCCTGCCACAAATGATACTATCTCGAGATAGTATCATTTGTGGCAGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_145332.x-550s1c1
Sequence:CCGGCCCGTGTGAACCATCCTAATACTCGAGTATTAGGATGGTTCACACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145332.1-981s1c1
Sequence:CCGGCGGAAACCCTTTGATGAGATTCTCGAGAATCTCATCAAAGGGTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)