EMAIL THIS PAGE TO A FRIEND

MAP3K7CL

MAP3K7 C-terminal like

81 Gene Product Result for
Synonyms: C21orf7 HC21ORF7 TAK1L TAKL TAKL-1 TAKL-2 TAKL-4
UniProtKB ID: P57077, D3DSE0, Q8TCL9
Gene ID:
Mouse(224419) Map3k7 C-terminal like
Zebrafish(568142) map3k7 C-terminal like
domestic guinea pig(100713184) MAP3K7 C-terminal like
naked mole-rat(101704293) MAP3K7 C-terminal like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020152 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020152 Rosetta Predictions human pricing
NM_144854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228602 predicted 953
2 SASI_Hs01_00228603 predicted 933
3 SASI_Hs01_00228605 predicted 741
4 SASI_Hs02_00353047 predicted 936
5 SASI_Hs01_00228610 predicted 763
6 SASI_Hs01_00228606 predicted 533
7 SASI_Hs01_00228607 predicted 279
8 SASI_Hs01_00228608 predicted 1200
9 SASI_Hs01_00228609 predicted 587
10 SASI_Hs01_00228611 predicted 1286
11 SASI_Hs01_00228604 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340265 predicted 478
2 SASI_Mm02_00340266 predicted 332
3 SASI_Mm02_00340267 predicted 1229
4 SASI_Mm02_00340268 predicted 580
5 SASI_Mm02_00340269 predicted 767
6 SASI_Mm02_00340270 predicted 479
7 SASI_Mm02_00340271 predicted 1222
8 SASI_Mm02_00340272 predicted 386
9 SASI_Mm02_00340273 predicted 342
10 SASI_Mm02_00340274 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144854
MAP3K7CL MISSION shRNA Bacterial Glycerol Stock
MAP3K7 C-terminal like
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144854.2-1003s21c1
Sequence:CCGGACACACATTTATCTTAGTTAGCTCGAGCTAACTAAGATAAATGTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144854.1-1521s1c1
Sequence:CCGGCCGTTGAGTGAATGCAGAATTCTCGAGAATTCTGCATTCACTCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-506s1c1
Sequence:CCGGCTGCCAAATAGCAGAAGAGTACTCGAGTACTCTTCTGCTATTTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-360s1c1
Sequence:CCGGCGCATCGCGTTTAGCCTCAATCTCGAGATTGAGGCTAAACGCGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-621s1c1
Sequence:CCGGGCTCAGCTGGTTCAGGAATTTCTCGAGAAATTCCTGAACCAGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-503s1c1
Sequence:CCGGGCACTGCCAAATAGCAGAAGACTCGAGTCTTCTGCTATTTGGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144854
MAP3K7CL MISSION shRNA shRNA Plasmid DNA
MAP3K7 C-terminal like
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144854.2-1003s21c1
Sequence:CCGGACACACATTTATCTTAGTTAGCTCGAGCTAACTAAGATAAATGTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144854.1-1521s1c1
Sequence:CCGGCCGTTGAGTGAATGCAGAATTCTCGAGAATTCTGCATTCACTCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-506s1c1
Sequence:CCGGCTGCCAAATAGCAGAAGAGTACTCGAGTACTCTTCTGCTATTTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-360s1c1
Sequence:CCGGCGCATCGCGTTTAGCCTCAATCTCGAGATTGAGGCTAAACGCGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-621s1c1
Sequence:CCGGGCTCAGCTGGTTCAGGAATTTCTCGAGAAATTCCTGAACCAGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-503s1c1
Sequence:CCGGGCACTGCCAAATAGCAGAAGACTCGAGTCTTCTGCTATTTGGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144854
MAP3K7CL MISSION shRNA Lentiviral Transduction Particles
MAP3K7 C-terminal like
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144854.2-1003s21c1
Sequence:CCGGACACACATTTATCTTAGTTAGCTCGAGCTAACTAAGATAAATGTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144854.1-1521s1c1
Sequence:CCGGCCGTTGAGTGAATGCAGAATTCTCGAGAATTCTGCATTCACTCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-506s1c1
Sequence:CCGGCTGCCAAATAGCAGAAGAGTACTCGAGTACTCTTCTGCTATTTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-360s1c1
Sequence:CCGGCGCATCGCGTTTAGCCTCAATCTCGAGATTGAGGCTAAACGCGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-621s1c1
Sequence:CCGGGCTCAGCTGGTTCAGGAATTTCTCGAGAAATTCCTGAACCAGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144854.1-503s1c1
Sequence:CCGGGCACTGCCAAATAGCAGAAGACTCGAGTCTTCTGCTATTTGGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020152
MAP3K7CL MISSION shRNA Bacterial Glycerol Stock
MAP3K7 C-terminal like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020152.2-991s21c1
Sequence:CCGGGCAGGGCTCGTCCTAACTTTACTCGAGTAAAGTTAGGACGAGCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020152.2-595s21c1
Sequence:CCGGTCTGAAGCCAAAGTCTATTACCTCGAGGTAATAGACTTTGGCTTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020152.2-956s21c1
Sequence:CCGGCAACTGGAGAAACTTCGAATACTCGAGTATTCGAAGTTTCTCCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-762s1c1
Sequence:CCGGACTGCCAAATAGCAGAAGAATCTCGAGATTCTTCTGCTATTTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-935s1c1
Sequence:CCGGGCCCAGTCTCAATGTGTGGAACTCGAGTTCCACACATTGAGACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-658s1c1
Sequence:CCGGCCCTGAAGACTCCATTCCTTTCTCGAGAAAGGAATGGAGTCTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-686s1c1
Sequence:CCGGCCAGAATTAGACCAGCAGCTACTCGAGTAGCTGCTGGTCTAATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020152.2-1116s1c1
Sequence:CCGGCCACATGACAACTGTCTATAACTCGAGTTATAGACAGTTGTCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020152
MAP3K7CL MISSION shRNA shRNA Plasmid DNA
MAP3K7 C-terminal like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020152.2-991s21c1
Sequence:CCGGGCAGGGCTCGTCCTAACTTTACTCGAGTAAAGTTAGGACGAGCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020152.2-595s21c1
Sequence:CCGGTCTGAAGCCAAAGTCTATTACCTCGAGGTAATAGACTTTGGCTTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020152.2-956s21c1
Sequence:CCGGCAACTGGAGAAACTTCGAATACTCGAGTATTCGAAGTTTCTCCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-762s1c1
Sequence:CCGGACTGCCAAATAGCAGAAGAATCTCGAGATTCTTCTGCTATTTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-935s1c1
Sequence:CCGGGCCCAGTCTCAATGTGTGGAACTCGAGTTCCACACATTGAGACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-658s1c1
Sequence:CCGGCCCTGAAGACTCCATTCCTTTCTCGAGAAAGGAATGGAGTCTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-686s1c1
Sequence:CCGGCCAGAATTAGACCAGCAGCTACTCGAGTAGCTGCTGGTCTAATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020152.2-1116s1c1
Sequence:CCGGCCACATGACAACTGTCTATAACTCGAGTTATAGACAGTTGTCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020152
MAP3K7CL MISSION shRNA Lentiviral Transduction Particles
MAP3K7 C-terminal like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020152.2-991s21c1
Sequence:CCGGGCAGGGCTCGTCCTAACTTTACTCGAGTAAAGTTAGGACGAGCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020152.2-595s21c1
Sequence:CCGGTCTGAAGCCAAAGTCTATTACCTCGAGGTAATAGACTTTGGCTTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020152.2-956s21c1
Sequence:CCGGCAACTGGAGAAACTTCGAATACTCGAGTATTCGAAGTTTCTCCAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-762s1c1
Sequence:CCGGACTGCCAAATAGCAGAAGAATCTCGAGATTCTTCTGCTATTTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-935s1c1
Sequence:CCGGGCCCAGTCTCAATGTGTGGAACTCGAGTTCCACACATTGAGACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-658s1c1
Sequence:CCGGCCCTGAAGACTCCATTCCTTTCTCGAGAAAGGAATGGAGTCTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020152.2-686s1c1
Sequence:CCGGCCAGAATTAGACCAGCAGCTACTCGAGTAGCTGCTGGTCTAATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020152.2-1116s1c1
Sequence:CCGGCCACATGACAACTGTCTATAACTCGAGTTATAGACAGTTGTCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)