EMAIL THIS PAGE TO A FRIEND

MAP3K8

mitogen-activated protein kinase kinase kinase 8

118 Gene Product Result for
Synonyms: COT EST ESTF MEKK8 TPL2 Tpl-2 c-COT
UniProtKB ID: P41279, A8K2Q5, D3DRX1, Q14275, Q5T855, Q9HC81
Gene ID:
Human(1326) Summary: This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
Mouse(26410) mitogen-activated protein kinase kinase kinase 8
Rat(116596) mitogen-activated protein kinase kinase kinase 8
Zebrafish(563727) mitogen-activated protein kinase kinase kinase 8
cow(535622) mitogen-activated protein kinase kinase kinase 8
Horse(100063602) mitogen-activated protein kinase kinase kinase 8
domestic cat(101090624) mitogen-activated protein kinase kinase kinase 8
dog(487085) mitogen-activated protein kinase kinase kinase 8
chicken(420479) mitogen-activated protein kinase kinase kinase 8
naked mole-rat(101710286) mitogen-activated protein kinase kinase kinase 8
Domestic Rabbit(100355566) mitogen-activated protein kinase kinase kinase 8
domestic guinea pig(100725834) mitogen-activated protein kinase kinase kinase 8
sheep(101117094) mitogen-activated protein kinase kinase kinase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306409 ANTI-COT (MAP3K8/MEKK8)(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306400 ANTI-COT (MAP3K8/MEKK8)(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4500410 Anti-COT antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA017962 Anti-MAP3K8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV30649 Anti-MAP3K8 antibody produced in rabbit IgG fraction of antiserum dog, bovine, human, rat, horse
western blot pricing
SAB4500411 Anti-MAP3K8 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB2104351 Anti-MAP3K8, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1302488 ANTI-MOUSE MAP3K8 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4503811 Anti-phospho-COT (pThr290) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301300 Anti-phospho-MAP3K8 (pSer400) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1118 MCF10A CELLS MAP3K8 P461L human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005204 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005204 Rosetta Predictions human pricing
NM_053847 Rosetta Predictions rat pricing
NM_007746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339173 predicted 1243
2 SASI_Hs01_00044515 predicted 1145
3 SASI_Hs02_00339174 predicted 1966
4 SASI_Hs01_00044516 predicted 1444
5 SASI_Hs02_00339175 predicted 920
6 SASI_Hs01_00044517 predicted 1152
7 SASI_Hs01_00044518 predicted 1220
8 SASI_Hs01_00044521 predicted 1953
9 SASI_Hs01_00044522 predicted 1181
10 SASI_Hs01_00044524 predicted 2109
11 SASI_Hs01_00044519 predicted 1296
12 SASI_Hs01_00044520 predicted 1102
13 SASI_Hs01_00044523 predicted 2103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070694 predicted 1745
2 SASI_Rn01_00070696 predicted 1069
3 SASI_Rn01_00070697 predicted 999
4 SASI_Rn01_00070698 predicted 373
5 SASI_Rn01_00070699 predicted 590
6 SASI_Rn01_00070700 predicted 873
7 SASI_Rn01_00070701 predicted 1719
8 SASI_Rn01_00070702 predicted 429
9 SASI_Rn02_00266699 predicted 1759
10 SASI_Rn02_00266700 predicted 886
11 SASI_Rn01_00070693 predicted 728
12 SASI_Rn01_00070695 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157847 predicted 1546
2 SASI_Mm01_00157848 predicted 680
3 SASI_Mm01_00157849 predicted 390
4 SASI_Mm01_00157850 predicted 235
5 SASI_Mm01_00157852 predicted 478
6 SASI_Mm01_00157853 predicted 526
7 SASI_Mm01_00157854 predicted 874
8 SASI_Mm01_00157855 predicted 464
9 SASI_Mm01_00157856 predicted 889
10 SASI_Mm02_00312348 predicted 858
11 SASI_Mm01_00157851 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005204
VALIDATED
MAP3K8 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 8
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005204.2-2532s21c1
Sequence:GTACCGGTTGAGCCTTTATTGGTAAATTCTCGAGAATTTACCAATAAAGGCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005204.2-766s21c1
Sequence:GTACCGGTCTGATGTAATAGACATTATGCTCGAGCATAATGTCTATTACATCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.2-1092s1c1
Sequence:CCGGGAAGCTGACTTACAGGAATATCTCGAGATATTCCTGTAAGTCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.2-1104s1c1
Sequence:CCGGCAGGAATATTGGTTCTGATTTCTCGAGAAATCAGAACCAATATTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.2-958s1c1
Sequence:CCGGGCAAACCATATATCCAACACTCTCGAGAGTGTTGGATATATGGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.2-1059s1c1
Sequence:CCGGCCAAATAGATTCCGATGTTCTCTCGAGAGAACATCGGAATCTATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005204.2-2809s1c1
Sequence:CCGGGATGAGAATGTGACCTTTAAGCTCGAGCTTAAAGGTCACATTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.x-870s1c1
Sequence:CCGGGCGTTCTAAGTCTCTGCTGCTCTCGAGAGCAGCAGAGACTTAGAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.x-1602s1c1
Sequence:CCGGGGGCCATTCAACCAAAGCAGACTCGAGTCTGCTTTGGTTGAATGGCCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005204.2-802s21c1
Sequence:GTACCGGAGTGAAGAGCCAGCAGTTTATCTCGAGATAAACTGCTGGCTCTTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.x-1826s1c1
Sequence:CCGGCAAGAGCCGCAGACCTACTAACTCGAGTTAGTAGGTCTGCGGCTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.x-1510s1c1
Sequence:CCGGGGCCTAAGTGTTCAAATGACCCTCGAGGGTCATTTGAACACTTAGGCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.x-1184s1c1
Sequence:CCGGGAATGGCGTGTAAACTGATCCCTCGAGGGATCAGTTTACACGCCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005204
VALIDATED
MAP3K8 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 8
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005204.2-2532s21c1
Sequence:GTACCGGTTGAGCCTTTATTGGTAAATTCTCGAGAATTTACCAATAAAGGCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005204.2-766s21c1
Sequence:GTACCGGTCTGATGTAATAGACATTATGCTCGAGCATAATGTCTATTACATCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.2-1092s1c1
Sequence:CCGGGAAGCTGACTTACAGGAATATCTCGAGATATTCCTGTAAGTCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.2-1104s1c1
Sequence:CCGGCAGGAATATTGGTTCTGATTTCTCGAGAAATCAGAACCAATATTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.2-958s1c1
Sequence:CCGGGCAAACCATATATCCAACACTCTCGAGAGTGTTGGATATATGGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.2-1059s1c1
Sequence:CCGGCCAAATAGATTCCGATGTTCTCTCGAGAGAACATCGGAATCTATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005204.2-2809s1c1
Sequence:CCGGGATGAGAATGTGACCTTTAAGCTCGAGCTTAAAGGTCACATTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.x-870s1c1
Sequence:CCGGGCGTTCTAAGTCTCTGCTGCTCTCGAGAGCAGCAGAGACTTAGAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.x-1602s1c1
Sequence:CCGGGGGCCATTCAACCAAAGCAGACTCGAGTCTGCTTTGGTTGAATGGCCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005204.2-802s21c1
Sequence:GTACCGGAGTGAAGAGCCAGCAGTTTATCTCGAGATAAACTGCTGGCTCTTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.x-1826s1c1
Sequence:CCGGCAAGAGCCGCAGACCTACTAACTCGAGTTAGTAGGTCTGCGGCTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.x-1510s1c1
Sequence:CCGGGGCCTAAGTGTTCAAATGACCCTCGAGGGTCATTTGAACACTTAGGCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.x-1184s1c1
Sequence:CCGGGAATGGCGTGTAAACTGATCCCTCGAGGGATCAGTTTACACGCCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005204
VALIDATED
MAP3K8 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 8
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005204.2-2532s21c1
Sequence:GTACCGGTTGAGCCTTTATTGGTAAATTCTCGAGAATTTACCAATAAAGGCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005204.2-766s21c1
Sequence:GTACCGGTCTGATGTAATAGACATTATGCTCGAGCATAATGTCTATTACATCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.2-1092s1c1
Sequence:CCGGGAAGCTGACTTACAGGAATATCTCGAGATATTCCTGTAAGTCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.2-1104s1c1
Sequence:CCGGCAGGAATATTGGTTCTGATTTCTCGAGAAATCAGAACCAATATTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.2-958s1c1
Sequence:CCGGGCAAACCATATATCCAACACTCTCGAGAGTGTTGGATATATGGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.2-1059s1c1
Sequence:CCGGCCAAATAGATTCCGATGTTCTCTCGAGAGAACATCGGAATCTATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005204.2-2809s1c1
Sequence:CCGGGATGAGAATGTGACCTTTAAGCTCGAGCTTAAAGGTCACATTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.x-870s1c1
Sequence:CCGGGCGTTCTAAGTCTCTGCTGCTCTCGAGAGCAGCAGAGACTTAGAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.x-1602s1c1
Sequence:CCGGGGGCCATTCAACCAAAGCAGACTCGAGTCTGCTTTGGTTGAATGGCCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005204.2-802s21c1
Sequence:GTACCGGAGTGAAGAGCCAGCAGTTTATCTCGAGATAAACTGCTGGCTCTTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005204.x-1826s1c1
Sequence:CCGGCAAGAGCCGCAGACCTACTAACTCGAGTTAGTAGGTCTGCGGCTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.x-1510s1c1
Sequence:CCGGGGCCTAAGTGTTCAAATGACCCTCGAGGGTCATTTGAACACTTAGGCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005204.x-1184s1c1
Sequence:CCGGGAATGGCGTGTAAACTGATCCCTCGAGGGATCAGTTTACACGCCATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007746
MAP3K8 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007746.2-192s21c1
Sequence:CCGGTGTCAGAAGTCATAGACATAACTCGAGTTATGTCTATGACTTCTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007746.2-2260s21c1
Sequence:CCGGTGGTAATGCCTCCGTTGTAATCTCGAGATTACAACGGAGGCATTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007746.2-868s21c1
Sequence:GTACCGGAGTGATCCACCATGATATTAACTCGAGTTAATATCATGGTGGATCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007746.2-617s21c1
Sequence:CCGGGCGTGCAAACTGATCCCTATACTCGAGTATAGGGATCAGTTTGCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-617s1c1
Sequence:CCGGGCGTGCAAACTGATCCCTATACTCGAGTATAGGGATCAGTTTGCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-428s1c1
Sequence:CCGGCGACCACAAGAATGTGGAATTCTCGAGAATTCCACATTCTTGTGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-190s1c1
Sequence:CCGGCGTGTCAGAAGTCATAGACATCTCGAGATGTCTATGACTTCTGACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-1262s1c1
Sequence:CCGGGCAGACCTACTGAAACATGAACTCGAGTTCATGTTTCAGTAGGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-894s1c1
Sequence:CCGGGCAACATTGTATTCATGTCTACTCGAGTAGACATGAATACAATGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007746
MAP3K8 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007746.2-192s21c1
Sequence:CCGGTGTCAGAAGTCATAGACATAACTCGAGTTATGTCTATGACTTCTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007746.2-2260s21c1
Sequence:CCGGTGGTAATGCCTCCGTTGTAATCTCGAGATTACAACGGAGGCATTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007746.2-868s21c1
Sequence:GTACCGGAGTGATCCACCATGATATTAACTCGAGTTAATATCATGGTGGATCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007746.2-617s21c1
Sequence:CCGGGCGTGCAAACTGATCCCTATACTCGAGTATAGGGATCAGTTTGCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-617s1c1
Sequence:CCGGGCGTGCAAACTGATCCCTATACTCGAGTATAGGGATCAGTTTGCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-428s1c1
Sequence:CCGGCGACCACAAGAATGTGGAATTCTCGAGAATTCCACATTCTTGTGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-190s1c1
Sequence:CCGGCGTGTCAGAAGTCATAGACATCTCGAGATGTCTATGACTTCTGACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-1262s1c1
Sequence:CCGGGCAGACCTACTGAAACATGAACTCGAGTTCATGTTTCAGTAGGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-894s1c1
Sequence:CCGGGCAACATTGTATTCATGTCTACTCGAGTAGACATGAATACAATGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007746
MAP3K8 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007746.2-192s21c1
Sequence:CCGGTGTCAGAAGTCATAGACATAACTCGAGTTATGTCTATGACTTCTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007746.2-2260s21c1
Sequence:CCGGTGGTAATGCCTCCGTTGTAATCTCGAGATTACAACGGAGGCATTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007746.2-868s21c1
Sequence:GTACCGGAGTGATCCACCATGATATTAACTCGAGTTAATATCATGGTGGATCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007746.2-617s21c1
Sequence:CCGGGCGTGCAAACTGATCCCTATACTCGAGTATAGGGATCAGTTTGCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-617s1c1
Sequence:CCGGGCGTGCAAACTGATCCCTATACTCGAGTATAGGGATCAGTTTGCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-428s1c1
Sequence:CCGGCGACCACAAGAATGTGGAATTCTCGAGAATTCCACATTCTTGTGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-190s1c1
Sequence:CCGGCGTGTCAGAAGTCATAGACATCTCGAGATGTCTATGACTTCTGACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-1262s1c1
Sequence:CCGGGCAGACCTACTGAAACATGAACTCGAGTTCATGTTTCAGTAGGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007746.1-894s1c1
Sequence:CCGGGCAACATTGTATTCATGTCTACTCGAGTAGACATGAATACAATGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)