EMAIL THIS PAGE TO A FRIEND

MAP3K9

mitogen-activated protein kinase kinase kinase 9

144 Gene Product Result for
Synonyms: MEKK9 MLK1 PRKE1
UniProtKB ID: P80192, A3KN85, Q0D2G7, Q6EH31, Q9H2N5
Gene ID:
Mouse(338372) mitogen-activated protein kinase kinase kinase 9
Rat(500690) mitogen-activated protein kinase kinase kinase 9
sheep(101103160) mitogen-activated protein kinase kinase kinase 9
domestic guinea pig(100715894) mitogen-activated protein kinase kinase kinase 9
Domestic Rabbit(100341731) mitogen-activated protein kinase kinase kinase 9
naked mole-rat(101696673) mitogen-activated protein kinase kinase kinase 9
chicken(776822) mitogen-activated protein kinase kinase kinase 9
dog(490765) mitogen-activated protein kinase kinase kinase 9
Horse(100054289) mitogen-activated protein kinase kinase kinase 9
cow(538340) mitogen-activated protein kinase kinase kinase 9
domestic cat(101084717) mitogen-activated protein kinase kinase kinase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_027237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_027237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_027237 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033141 Rosetta Predictions human pricing
XM_576071 Rosetta Predictions rat pricing
XR_007371 Rosetta Predictions rat pricing
NM_177395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360877 predicted 2605
2 SASI_Hs01_00143151 predicted 799
3 SASI_Hs01_00143152 predicted 3318
4 SASI_Hs01_00143153 predicted 761
5 SASI_Hs01_00143154 predicted 1682
6 SASI_Hs01_00143155 predicted 2010
7 SASI_Hs01_00143156 predicted 723
8 SASI_Hs02_00360878 predicted 2700
9 SASI_Hs02_00360879 predicted 2602
10 SASI_Hs01_00143158 predicted 1097
11 SASI_Hs01_00143150 predicted 752
12 SASI_Hs01_00143157 predicted 1185
13 SASI_Hs01_00143159 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404719 predicted 1960
2 SASI_Rn02_00404720 predicted 807
3 SASI_Rn02_00404721 predicted 751
4 SASI_Rn02_00404722 predicted 1329
5 SASI_Rn02_00404723 predicted 2300
6 SASI_Rn02_00404724 predicted 1077
7 SASI_Rn02_00404725 predicted 1025
8 SASI_Rn02_00404726 predicted 1132
9 SASI_Rn02_00404727 predicted 2301
10 SASI_Rn02_00404728 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173319 predicted 3411
2 SASI_Rn01_00173321 predicted 3445
3 SASI_Rn01_00173322 predicted 3458
4 SASI_Rn01_00173323 predicted 3458
5 SASI_Rn01_00173324 predicted 2838
6 SASI_Rn02_00414404 predicted 3421
7 SASI_Rn01_00173325 predicted 3450
8 SASI_Rn01_00173326 predicted 3175
9 SASI_Rn01_00173327 predicted 3424
10 SASI_Rn01_00173328 predicted 3220
11 SASI_Rn01_00173320 predicted 3411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022705 predicted 964
2 SASI_Mm01_00022706 predicted 923
3 SASI_Mm01_00022707 predicted 1159
4 SASI_Mm01_00022708 predicted 635
5 SASI_Mm01_00022709 predicted 910
6 SASI_Mm01_00022710 predicted 1949
7 SASI_Mm01_00022711 predicted 503
8 SASI_Mm01_00022712 predicted 2008
9 SASI_Mm01_00022713 predicted 1797
10 SASI_Mm01_00022714 predicted 1333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_027237
VALIDATED
MAP3K9 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027237.7-397s1c1
Sequence:CCGGCCGCCCATTCAGTTGTTAGAACTCGAGTTCTAACAACTGAATGGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_027237.7-1887s1c1
Sequence:CCGGCCCATCAGAATCTCCACATTTCTCGAGAAATGTGGAGATTCTGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_027237.7-3459s1c1
Sequence:CCGGCCCTACTTCTTGCACTGATAACTCGAGTTATCAGTGCAAGAAGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027237.7-867s1c1
Sequence:CCGGGATTCTGAAGATCACTGATTTCTCGAGAAATCAGTGATCTTCAGAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_027237.7-2703s1c1
Sequence:CCGGGCGCTTCAAACGAGATCCTAACTCGAGTTAGGATCTCGTTTGAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_027237
VALIDATED
MAP3K9 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027237.7-397s1c1
Sequence:CCGGCCGCCCATTCAGTTGTTAGAACTCGAGTTCTAACAACTGAATGGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_027237.7-1887s1c1
Sequence:CCGGCCCATCAGAATCTCCACATTTCTCGAGAAATGTGGAGATTCTGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_027237.7-3459s1c1
Sequence:CCGGCCCTACTTCTTGCACTGATAACTCGAGTTATCAGTGCAAGAAGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027237.7-867s1c1
Sequence:CCGGGATTCTGAAGATCACTGATTTCTCGAGAAATCAGTGATCTTCAGAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_027237.7-2703s1c1
Sequence:CCGGGCGCTTCAAACGAGATCCTAACTCGAGTTAGGATCTCGTTTGAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_027237
VALIDATED
MAP3K9 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027237.7-397s1c1
Sequence:CCGGCCGCCCATTCAGTTGTTAGAACTCGAGTTCTAACAACTGAATGGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_027237.7-1887s1c1
Sequence:CCGGCCCATCAGAATCTCCACATTTCTCGAGAAATGTGGAGATTCTGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_027237.7-3459s1c1
Sequence:CCGGCCCTACTTCTTGCACTGATAACTCGAGTTATCAGTGCAAGAAGTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027237.7-867s1c1
Sequence:CCGGGATTCTGAAGATCACTGATTTCTCGAGAAATCAGTGATCTTCAGAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_027237.7-2703s1c1
Sequence:CCGGGCGCTTCAAACGAGATCCTAACTCGAGTTAGGATCTCGTTTGAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033141
VALIDATED
MAP3K9 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033141.2-3775s21c1
Sequence:CCGGTGGATATTCTGTGATTGATTTCTCGAGAAATCAATCACAGAATATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-1920s21c1
Sequence:CCGGGTCCCTGGTAGATGGATATAACTCGAGTTATATCCATCTACCAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033141.2-4317s1c1
Sequence:CCGGCCTTTGGTCTTCACTCTAATCCTCGAGGATTAGAGTGAAGACCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-1271s21c1
Sequence:CCGGACAACTGGAAACACGAGATTCCTCGAGGAATCTCGTGTTTCCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033141.2-5039s1c1
Sequence:CCGGCCTTGCTTTATGAGCCCATTACTCGAGTAATGGGCTCATAAAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_033141.2-749s1c1
Sequence:CCGGCCAGAGGGATGAACTACTTACCTCGAGGTAAGTAGTTCATCCCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_033141.2-2603s1c1
Sequence:CCGGGCGATGAAATTGTCGTGTATGCTCGAGCATACACGACAATTTCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033141.2-677s1c1
Sequence:CCGGGACCTTTGAATAGAGTGTTATCTCGAGATAACACTCTATTCAAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-1176s21c1
Sequence:CCGGACGACCATCTTTCACGAATATCTCGAGATATTCGTGAAAGATGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-2603s21c1
Sequence:CCGGGCGATGAAATTGTCGTGTATGCTCGAGCATACACGACAATTTCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033141
VALIDATED
MAP3K9 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033141.2-3775s21c1
Sequence:CCGGTGGATATTCTGTGATTGATTTCTCGAGAAATCAATCACAGAATATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-1920s21c1
Sequence:CCGGGTCCCTGGTAGATGGATATAACTCGAGTTATATCCATCTACCAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033141.2-4317s1c1
Sequence:CCGGCCTTTGGTCTTCACTCTAATCCTCGAGGATTAGAGTGAAGACCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-1271s21c1
Sequence:CCGGACAACTGGAAACACGAGATTCCTCGAGGAATCTCGTGTTTCCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033141.2-5039s1c1
Sequence:CCGGCCTTGCTTTATGAGCCCATTACTCGAGTAATGGGCTCATAAAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_033141.2-749s1c1
Sequence:CCGGCCAGAGGGATGAACTACTTACCTCGAGGTAAGTAGTTCATCCCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_033141.2-2603s1c1
Sequence:CCGGGCGATGAAATTGTCGTGTATGCTCGAGCATACACGACAATTTCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033141.2-677s1c1
Sequence:CCGGGACCTTTGAATAGAGTGTTATCTCGAGATAACACTCTATTCAAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-1176s21c1
Sequence:CCGGACGACCATCTTTCACGAATATCTCGAGATATTCGTGAAAGATGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-2603s21c1
Sequence:CCGGGCGATGAAATTGTCGTGTATGCTCGAGCATACACGACAATTTCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033141
VALIDATED
MAP3K9 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033141.2-3775s21c1
Sequence:CCGGTGGATATTCTGTGATTGATTTCTCGAGAAATCAATCACAGAATATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-1920s21c1
Sequence:CCGGGTCCCTGGTAGATGGATATAACTCGAGTTATATCCATCTACCAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033141.2-4317s1c1
Sequence:CCGGCCTTTGGTCTTCACTCTAATCCTCGAGGATTAGAGTGAAGACCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-1271s21c1
Sequence:CCGGACAACTGGAAACACGAGATTCCTCGAGGAATCTCGTGTTTCCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033141.2-5039s1c1
Sequence:CCGGCCTTGCTTTATGAGCCCATTACTCGAGTAATGGGCTCATAAAGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_033141.2-749s1c1
Sequence:CCGGCCAGAGGGATGAACTACTTACCTCGAGGTAAGTAGTTCATCCCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_033141.2-2603s1c1
Sequence:CCGGGCGATGAAATTGTCGTGTATGCTCGAGCATACACGACAATTTCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033141.2-677s1c1
Sequence:CCGGGACCTTTGAATAGAGTGTTATCTCGAGATAACACTCTATTCAAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-1176s21c1
Sequence:CCGGACGACCATCTTTCACGAATATCTCGAGATATTCGTGAAAGATGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033141.2-2603s21c1
Sequence:CCGGGCGATGAAATTGTCGTGTATGCTCGAGCATACACGACAATTTCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177395
MAP3K9 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-1559s1c1
Sequence:CCGGGCGAGAGCTCAATATCATCATCTCGAGATGATGATATTGAGCTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-858s21c1
Sequence:CCGGTCGCCAGAGGGATGAACTATCCTCGAGGATAGTTCATCCCTCTGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-1295s1c1
Sequence:CCGGCCCATCTTTCACGAGTATCCTCTCGAGAGGATACTCGTGAAAGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-581s1c1
Sequence:CCGGTGGGAAAGTTTATCGTGCTTTCTCGAGAAAGCACGATAAACTTTCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-800s1c1
Sequence:CCGGGAACAGAGTATTGTCTGGGAACTCGAGTTCCCAGACAATACTCTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-968s1c1
Sequence:CCGGCCTGAGTAACAAGATTCTGAACTCGAGTTCAGAATCTTGTTACTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-915s21c1
Sequence:CCGGACCTTAAGTCCAGCAACATATCTCGAGATATGTTGCTGGACTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-1188s21c1
Sequence:CCGGACGGTGTGGCCATGAACAAACCTCGAGGTTTGTTCATGGCCACACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-1310s21c1
Sequence:CCGGCTGGACCAGCTAACGACTATACTCGAGTATAGTCGTTAGCTGGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177395
MAP3K9 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-1559s1c1
Sequence:CCGGGCGAGAGCTCAATATCATCATCTCGAGATGATGATATTGAGCTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-858s21c1
Sequence:CCGGTCGCCAGAGGGATGAACTATCCTCGAGGATAGTTCATCCCTCTGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-1295s1c1
Sequence:CCGGCCCATCTTTCACGAGTATCCTCTCGAGAGGATACTCGTGAAAGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-581s1c1
Sequence:CCGGTGGGAAAGTTTATCGTGCTTTCTCGAGAAAGCACGATAAACTTTCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-800s1c1
Sequence:CCGGGAACAGAGTATTGTCTGGGAACTCGAGTTCCCAGACAATACTCTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-968s1c1
Sequence:CCGGCCTGAGTAACAAGATTCTGAACTCGAGTTCAGAATCTTGTTACTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-915s21c1
Sequence:CCGGACCTTAAGTCCAGCAACATATCTCGAGATATGTTGCTGGACTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-1188s21c1
Sequence:CCGGACGGTGTGGCCATGAACAAACCTCGAGGTTTGTTCATGGCCACACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-1310s21c1
Sequence:CCGGCTGGACCAGCTAACGACTATACTCGAGTATAGTCGTTAGCTGGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177395
MAP3K9 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-1559s1c1
Sequence:CCGGGCGAGAGCTCAATATCATCATCTCGAGATGATGATATTGAGCTCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-858s21c1
Sequence:CCGGTCGCCAGAGGGATGAACTATCCTCGAGGATAGTTCATCCCTCTGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-1295s1c1
Sequence:CCGGCCCATCTTTCACGAGTATCCTCTCGAGAGGATACTCGTGAAAGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-581s1c1
Sequence:CCGGTGGGAAAGTTTATCGTGCTTTCTCGAGAAAGCACGATAAACTTTCCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-800s1c1
Sequence:CCGGGAACAGAGTATTGTCTGGGAACTCGAGTTCCCAGACAATACTCTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177395.2-968s1c1
Sequence:CCGGCCTGAGTAACAAGATTCTGAACTCGAGTTCAGAATCTTGTTACTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-915s21c1
Sequence:CCGGACCTTAAGTCCAGCAACATATCTCGAGATATGTTGCTGGACTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-1188s21c1
Sequence:CCGGACGGTGTGGCCATGAACAAACCTCGAGGTTTGTTCATGGCCACACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177395.4-1310s21c1
Sequence:CCGGCTGGACCAGCTAACGACTATACTCGAGTATAGTCGTTAGCTGGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)