EMAIL THIS PAGE TO A FRIEND

MAP4K1

mitogen-activated protein kinase kinase kinase kinase 1

85 Gene Product Result for
Synonyms: HPK1
UniProtKB ID: Q92918
Gene ID:
Mouse(26411) mitogen-activated protein kinase kinase kinase kinase 1
Rat(292763) mitogen activated protein kinase kinase kinase kinase 1
sheep(101111480) mitogen-activated protein kinase kinase kinase kinase 1
domestic guinea pig(100732370) mitogen-activated protein kinase kinase kinase kinase 1
naked mole-rat(101709569) mitogen-activated protein kinase kinase kinase kinase 1
cow(522002) mitogen-activated protein kinase kinase kinase kinase 1
Horse(100064279) mitogen-activated protein kinase kinase kinase kinase 1
domestic cat(101101431) mitogen-activated protein kinase kinase kinase kinase 1
dog(484527) mitogen-activated protein kinase kinase kinase kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042600 Rosetta Predictions human pricing
NM_007181 Rosetta Predictions human pricing
NM_001106243 Rosetta Predictions rat pricing
NM_008279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310758 predicted 897
2 SASI_Hs02_00310759 predicted 524
3 SASI_Hs02_00310760 predicted 713
4 SASI_Hs02_00310761 predicted 338
5 SASI_Hs02_00310762 predicted 866
6 SASI_Hs02_00310763 predicted 1302
7 SASI_Hs02_00310764 predicted 520
8 SASI_Hs02_00310765 predicted 479
9 SASI_Hs02_00310766 predicted 902
10 SASI_Hs02_00310767 predicted 2204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163604 predicted 902
2 SASI_Hs01_00163608 predicted 526
3 SASI_Hs01_00163609 predicted 716
4 SASI_Hs01_00163610 predicted 343
5 SASI_Hs02_00343141 predicted 867
6 SASI_Hs01_00163611 predicted 1301
7 SASI_Hs01_00163612 predicted 525
8 SASI_Hs02_00343142 predicted 476
9 SASI_Hs02_00343143 predicted 905
10 SASI_Hs01_00163613 predicted 2202
11 SASI_Hs01_00163605 predicted 625
12 SASI_Hs01_00163606 predicted 426
13 SASI_Hs01_00163607 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217048 predicted 867
2 SASI_Rn02_00217049 predicted 822
3 SASI_Rn02_00217050 predicted 1577
4 SASI_Rn02_00217051 predicted 288
5 SASI_Rn02_00217052 predicted 2164
6 SASI_Rn02_00217053 predicted 893
7 SASI_Rn02_00217054 predicted 1223
8 SASI_Rn02_00217055 predicted 212
9 SASI_Rn02_00217056 predicted 1126
10 SASI_Rn02_00217057 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057731 predicted 860
2 SASI_Mm01_00057733 predicted 215
3 SASI_Mm01_00057734 predicted 604
4 SASI_Mm01_00057735 predicted 667
5 SASI_Mm01_00057736 predicted 1867
6 SASI_Mm01_00057737 predicted 1296
7 SASI_Mm01_00057738 predicted 893
8 SASI_Mm01_00057739 predicted 2357
9 SASI_Mm02_00313540 predicted 1990
10 SASI_Mm01_00057740 predicted 2281
11 SASI_Mm01_00057732 predicted 1159
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007181
VALIDATED
MAP4K1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-2707s1c1
Sequence:CCGGACATGACTTTAGCCTCTGCAACTCGAGTTGCAGAGGCTAAAGTCATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-1703s21c1
Sequence:CCGGCCACGCTGGAAATGCTCTTTCCTCGAGGAAAGAGCATTTCCAGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-1826s1c1
Sequence:CCGGTGGCAAGGAAGAACATGGTTTCTCGAGAAACCATGTTCTTCCTTGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-790s1c1
Sequence:CCGGGCCTTCCACAACTTCATCAAACTCGAGTTTGATGAAGTTGTGGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-447s1c1
Sequence:CCGGGAAGAAGATACACAGGGACATCTCGAGATGTCCCTGTGTATCTTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007181.x-196s1c1
Sequence:CCGGGTGAAGATGGAGCCTGATGATCTCGAGATCATCAGGCTCCATCTTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007181.4-2631s1c1
Sequence:CCGGGATGATCCTACTGCTCCCAGCCTCGAGGCTGGGAGCAGTAGGATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-527s21c1
Sequence:CCGGGAGCTAACATCCTCATCAATGCTCGAGCATTGATGAGGATGTTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-1737s1c1
Sequence:CCGGGTGGGTGTACTCCATCAACAACTCGAGTTGTTGATGGAGTACACCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-334s1c1
Sequence:CCGGGCCTACCATGGGAGTTATCTCCTCGAGGAGATAACTCCCATGGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-2623s1c1
Sequence:CCGGGCCCAGTGGATGATCCTACTGCTCGAGCAGTAGGATCATCCACTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-1556s1c1
Sequence:CCGGGATGTGCCCTTCTCGTAAAGTCTCGAGACTTTACGAGAAGGGCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-608s21c1
Sequence:CCGGCCAGACGCCTCTCTTTCATTGCTCGAGCAATGAAAGAGAGGCGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-1232s21c1
Sequence:CCGGAGTCGTCTGACGATGACTATGCTCGAGCATAGTCATCGTCAGACGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-437s21c1
Sequence:CCGGCAGAGCTCCAGATTAGCTATGCTCGAGCATAGCTAATCTGGAGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007181
VALIDATED
MAP4K1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-2707s1c1
Sequence:CCGGACATGACTTTAGCCTCTGCAACTCGAGTTGCAGAGGCTAAAGTCATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-1703s21c1
Sequence:CCGGCCACGCTGGAAATGCTCTTTCCTCGAGGAAAGAGCATTTCCAGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-1826s1c1
Sequence:CCGGTGGCAAGGAAGAACATGGTTTCTCGAGAAACCATGTTCTTCCTTGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-790s1c1
Sequence:CCGGGCCTTCCACAACTTCATCAAACTCGAGTTTGATGAAGTTGTGGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-447s1c1
Sequence:CCGGGAAGAAGATACACAGGGACATCTCGAGATGTCCCTGTGTATCTTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007181.x-196s1c1
Sequence:CCGGGTGAAGATGGAGCCTGATGATCTCGAGATCATCAGGCTCCATCTTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007181.4-2631s1c1
Sequence:CCGGGATGATCCTACTGCTCCCAGCCTCGAGGCTGGGAGCAGTAGGATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-527s21c1
Sequence:CCGGGAGCTAACATCCTCATCAATGCTCGAGCATTGATGAGGATGTTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-1737s1c1
Sequence:CCGGGTGGGTGTACTCCATCAACAACTCGAGTTGTTGATGGAGTACACCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-334s1c1
Sequence:CCGGGCCTACCATGGGAGTTATCTCCTCGAGGAGATAACTCCCATGGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-2623s1c1
Sequence:CCGGGCCCAGTGGATGATCCTACTGCTCGAGCAGTAGGATCATCCACTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-1556s1c1
Sequence:CCGGGATGTGCCCTTCTCGTAAAGTCTCGAGACTTTACGAGAAGGGCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-608s21c1
Sequence:CCGGCCAGACGCCTCTCTTTCATTGCTCGAGCAATGAAAGAGAGGCGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-1232s21c1
Sequence:CCGGAGTCGTCTGACGATGACTATGCTCGAGCATAGTCATCGTCAGACGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-437s21c1
Sequence:CCGGCAGAGCTCCAGATTAGCTATGCTCGAGCATAGCTAATCTGGAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007181
VALIDATED
MAP4K1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-2707s1c1
Sequence:CCGGACATGACTTTAGCCTCTGCAACTCGAGTTGCAGAGGCTAAAGTCATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-1703s21c1
Sequence:CCGGCCACGCTGGAAATGCTCTTTCCTCGAGGAAAGAGCATTTCCAGCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-1826s1c1
Sequence:CCGGTGGCAAGGAAGAACATGGTTTCTCGAGAAACCATGTTCTTCCTTGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-790s1c1
Sequence:CCGGGCCTTCCACAACTTCATCAAACTCGAGTTTGATGAAGTTGTGGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.x-447s1c1
Sequence:CCGGGAAGAAGATACACAGGGACATCTCGAGATGTCCCTGTGTATCTTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007181.x-196s1c1
Sequence:CCGGGTGAAGATGGAGCCTGATGATCTCGAGATCATCAGGCTCCATCTTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007181.4-2631s1c1
Sequence:CCGGGATGATCCTACTGCTCCCAGCCTCGAGGCTGGGAGCAGTAGGATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-527s21c1
Sequence:CCGGGAGCTAACATCCTCATCAATGCTCGAGCATTGATGAGGATGTTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-1737s1c1
Sequence:CCGGGTGGGTGTACTCCATCAACAACTCGAGTTGTTGATGGAGTACACCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-334s1c1
Sequence:CCGGGCCTACCATGGGAGTTATCTCCTCGAGGAGATAACTCCCATGGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-2623s1c1
Sequence:CCGGGCCCAGTGGATGATCCTACTGCTCGAGCAGTAGGATCATCCACTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007181.4-1556s1c1
Sequence:CCGGGATGTGCCCTTCTCGTAAAGTCTCGAGACTTTACGAGAAGGGCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-608s21c1
Sequence:CCGGCCAGACGCCTCTCTTTCATTGCTCGAGCAATGAAAGAGAGGCGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-1232s21c1
Sequence:CCGGAGTCGTCTGACGATGACTATGCTCGAGCATAGTCATCGTCAGACGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007181.4-437s21c1
Sequence:CCGGCAGAGCTCCAGATTAGCTATGCTCGAGCATAGCTAATCTGGAGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008279
MAP4K1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-1226s1c1
Sequence:CCGGCGACTATGATGATGTGGACATCTCGAGATGTCCACATCATCATAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-2250s21c1
Sequence:CCGGAGTGCAGGTGATCCAAGTAAACTCGAGTTTACTTGGATCACCTGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-1797s21c1
Sequence:CCGGACCCTACCTGTATTCTCATAGCTCGAGCTATGAGAATACAGGTAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008279.1-2100s1c1
Sequence:CCGGCCAATGAACAAATTCTTGCTTCTCGAGAAGCAAGAATTTGTTCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-1149s1c1
Sequence:CCGGGCTGAAACTGTTCGCTTATATCTCGAGATATAAGCGAACAGTTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-600s1c1
Sequence:CCGGCGCCTTTCTTTCATTGGGACACTCGAGTGTCCCAATGAAAGAAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-353s1c1
Sequence:CCGGGCTGTGGATCTGCATGGAATTCTCGAGAATTCCATGCAGATCCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-2289s21c1
Sequence:CCGGGTTGATGGATGGCTCTCTAAACTCGAGTTTAGAGAGCCATCCATCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-1882s21c1
Sequence:CCGGCACCGGTTACTGGCAAGAAAGCTCGAGCTTTCTTGCCAGTAACCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008279
MAP4K1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-1226s1c1
Sequence:CCGGCGACTATGATGATGTGGACATCTCGAGATGTCCACATCATCATAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-2250s21c1
Sequence:CCGGAGTGCAGGTGATCCAAGTAAACTCGAGTTTACTTGGATCACCTGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-1797s21c1
Sequence:CCGGACCCTACCTGTATTCTCATAGCTCGAGCTATGAGAATACAGGTAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008279.1-2100s1c1
Sequence:CCGGCCAATGAACAAATTCTTGCTTCTCGAGAAGCAAGAATTTGTTCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-1149s1c1
Sequence:CCGGGCTGAAACTGTTCGCTTATATCTCGAGATATAAGCGAACAGTTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-600s1c1
Sequence:CCGGCGCCTTTCTTTCATTGGGACACTCGAGTGTCCCAATGAAAGAAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-353s1c1
Sequence:CCGGGCTGTGGATCTGCATGGAATTCTCGAGAATTCCATGCAGATCCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-2289s21c1
Sequence:CCGGGTTGATGGATGGCTCTCTAAACTCGAGTTTAGAGAGCCATCCATCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-1882s21c1
Sequence:CCGGCACCGGTTACTGGCAAGAAAGCTCGAGCTTTCTTGCCAGTAACCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008279
MAP4K1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-1226s1c1
Sequence:CCGGCGACTATGATGATGTGGACATCTCGAGATGTCCACATCATCATAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-2250s21c1
Sequence:CCGGAGTGCAGGTGATCCAAGTAAACTCGAGTTTACTTGGATCACCTGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-1797s21c1
Sequence:CCGGACCCTACCTGTATTCTCATAGCTCGAGCTATGAGAATACAGGTAGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008279.1-2100s1c1
Sequence:CCGGCCAATGAACAAATTCTTGCTTCTCGAGAAGCAAGAATTTGTTCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-1149s1c1
Sequence:CCGGGCTGAAACTGTTCGCTTATATCTCGAGATATAAGCGAACAGTTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-600s1c1
Sequence:CCGGCGCCTTTCTTTCATTGGGACACTCGAGTGTCCCAATGAAAGAAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008279.1-353s1c1
Sequence:CCGGGCTGTGGATCTGCATGGAATTCTCGAGAATTCCATGCAGATCCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-2289s21c1
Sequence:CCGGGTTGATGGATGGCTCTCTAAACTCGAGTTTAGAGAGCCATCCATCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008279.2-1882s21c1
Sequence:CCGGCACCGGTTACTGGCAAGAAAGCTCGAGCTTTCTTGCCAGTAACCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)