EMAIL THIS PAGE TO A FRIEND

MAP4K2

mitogen-activated protein kinase kinase kinase kinase 2

67 Gene Product Result for
Synonyms: BL44 GCK RAB8IP
UniProtKB ID: Q12851
Gene ID:
Human(5871) Summary: The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. [provided by RefSeq, Jul 2008]
Mouse(26412) mitogen-activated protein kinase kinase kinase kinase 2
Rat(293694) mitogen activated protein kinase kinase kinase kinase 2
Zebrafish(100538181) mitogen-activated protein kinase kinase kinase kinase 2
cow(520058) mitogen-activated protein kinase kinase kinase kinase 2
Horse(100056001) mitogen-activated protein kinase kinase kinase kinase 2
domestic cat(101094701) mitogen-activated protein kinase kinase kinase kinase 2
dog(483759) mitogen-activated protein kinase kinase kinase kinase 2
naked mole-rat(101710953) mitogen-activated protein kinase kinase kinase kinase 2
domestic guinea pig(100722708) mitogen-activated protein kinase kinase kinase kinase 2
sheep(101118145) mitogen-activated protein kinase kinase kinase kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004579 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004579 Rosetta Predictions human pricing
NM_001106329 Rosetta Predictions rat pricing
NM_009006 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059138 predicted 1969
2 SASI_Hs01_00059139 predicted 1618
3 SASI_Hs01_00059140 predicted 659
4 SASI_Hs01_00059142 predicted 1007
5 SASI_Hs01_00059143 predicted 1077
6 SASI_Hs01_00059144 predicted 329
7 SASI_Hs01_00059145 predicted 1272
8 SASI_Hs02_00337922 predicted 1227
9 SASI_Hs01_00059146 predicted 2220
10 SASI_Hs01_00059147 predicted 786
11 SASI_Hs01_00059141 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217898 predicted 2470
2 SASI_Rn02_00217899 predicted 340
3 SASI_Rn02_00217900 predicted 1981
4 SASI_Rn02_00217901 predicted 602
5 SASI_Rn02_00217902 predicted 340
6 SASI_Rn02_00217903 predicted 502
7 SASI_Rn02_00217904 predicted 517
8 SASI_Rn02_00217905 predicted 1736
9 SASI_Rn02_00217906 predicted 540
10 SASI_Rn02_00217907 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156281 predicted 1025
2 SASI_Mm01_00156282 predicted 2224
3 SASI_Mm01_00156283 predicted 1200
4 SASI_Mm01_00156284 predicted 502
5 SASI_Mm01_00156285 predicted 405
6 SASI_Mm01_00156286 predicted 1874
7 SASI_Mm01_00156287 predicted 2213
8 SASI_Mm01_00156288 predicted 2212
9 SASI_Mm01_00156289 predicted 247
10 SASI_Mm02_00315138 predicted 560
11 SASI_Mm01_00156290 predicted 2219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009006
VALIDATED
MAP4K2 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-330s21c1
Sequence:CCGGACGGCAGATTGCCTATGTTTGCTCGAGCAAACATAGGCAATCTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-1596s21c1
Sequence:CCGGCTGGCTCTACTGTGTGAACAACTCGAGTTGTTCACACAGTAGAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-664s21c1
Sequence:CCGGGCCTTGATGCTCATGTCGAAACTCGAGTTTCGACATGAGCATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-664s1c1
Sequence:CCGGGCCTTGATGCTCATGTCGAAACTCGAGTTTCGACATGAGCATCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-2221s1c1
Sequence:CCGGCTAACCTTTGACTTCACTATTCTCGAGAATAGTGAAGTCAAAGGTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-506s1c1
Sequence:CCGGGTTCTTTCATTGGCACTCCATCTCGAGATGGAGTGCCAATGAAAGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-1596s1c1
Sequence:CCGGCTGGCTCTACTGTGTGAACAACTCGAGTTGTTCACACAGTAGAGCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-249s1c1
Sequence:CCGGTGACCGATTGTGGATCTGTATCTCGAGATACAGATCCACAATCGGTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-2221s21c1
Sequence:CCGGCTAACCTTTGACTTCACTATTCTCGAGAATAGTGAAGTCAAAGGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009006
VALIDATED
MAP4K2 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-330s21c1
Sequence:CCGGACGGCAGATTGCCTATGTTTGCTCGAGCAAACATAGGCAATCTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-1596s21c1
Sequence:CCGGCTGGCTCTACTGTGTGAACAACTCGAGTTGTTCACACAGTAGAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-664s21c1
Sequence:CCGGGCCTTGATGCTCATGTCGAAACTCGAGTTTCGACATGAGCATCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-664s1c1
Sequence:CCGGGCCTTGATGCTCATGTCGAAACTCGAGTTTCGACATGAGCATCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-2221s1c1
Sequence:CCGGCTAACCTTTGACTTCACTATTCTCGAGAATAGTGAAGTCAAAGGTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-506s1c1
Sequence:CCGGGTTCTTTCATTGGCACTCCATCTCGAGATGGAGTGCCAATGAAAGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-1596s1c1
Sequence:CCGGCTGGCTCTACTGTGTGAACAACTCGAGTTGTTCACACAGTAGAGCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-249s1c1
Sequence:CCGGTGACCGATTGTGGATCTGTATCTCGAGATACAGATCCACAATCGGTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-2221s21c1
Sequence:CCGGCTAACCTTTGACTTCACTATTCTCGAGAATAGTGAAGTCAAAGGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009006
VALIDATED
MAP4K2 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-330s21c1
Sequence:CCGGACGGCAGATTGCCTATGTTTGCTCGAGCAAACATAGGCAATCTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-1596s21c1
Sequence:CCGGCTGGCTCTACTGTGTGAACAACTCGAGTTGTTCACACAGTAGAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-664s21c1
Sequence:CCGGGCCTTGATGCTCATGTCGAAACTCGAGTTTCGACATGAGCATCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-664s1c1
Sequence:CCGGGCCTTGATGCTCATGTCGAAACTCGAGTTTCGACATGAGCATCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-2221s1c1
Sequence:CCGGCTAACCTTTGACTTCACTATTCTCGAGAATAGTGAAGTCAAAGGTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-506s1c1
Sequence:CCGGGTTCTTTCATTGGCACTCCATCTCGAGATGGAGTGCCAATGAAAGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-1596s1c1
Sequence:CCGGCTGGCTCTACTGTGTGAACAACTCGAGTTGTTCACACAGTAGAGCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009006.1-249s1c1
Sequence:CCGGTGACCGATTGTGGATCTGTATCTCGAGATACAGATCCACAATCGGTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009006.2-2221s21c1
Sequence:CCGGCTAACCTTTGACTTCACTATTCTCGAGAATAGTGAAGTCAAAGGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004579
VALIDATED
MAP4K2 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004579.2-2728s1c1
Sequence:CCGGCCGACGCCTCTGCAATAACTGCTCGAGCAGTTATTGCAGAGGCGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004579.2-2670s1c1
Sequence:CCGGGCTGAAGGTCAGAAGTAATCCCTCGAGGGATTACTTCTGACCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004579.2-1083s1c1
Sequence:CCGGCAGTTTCACCAGGTGAAATTTCTCGAGAAATTTCACCTGGTGAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004579.2-537s1c1
Sequence:CCGGGATGTCAAACTGGCTGACTTTCTCGAGAAAGTCAGCCAGTTTGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.2-1505s1c1
Sequence:CCGGCGCCTGCTTCTCCAAGGTCTTCTCGAGAAGACCTTGGAGAAGCAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-387s1c1
Sequence:CCGGCAGGAGATTTACCATGCCACTCTCGAGAGTGGCATGGTAAATCTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-2303s1c1
Sequence:CCGGACCTGAGCTGACCTTTGATTTCTCGAGAAATCAAAGGTCAGCTCAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-850s1c1
Sequence:CCGGCCCTGACCAAGAATCCTAAGACTCGAGTCTTAGGATTCTTGGTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004579.x-2909s1c1
Sequence:CCGGCGGTATTTAAGAGAGAACTATCTCGAGATAGTTCTCTCTTAAATACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-790s1c1
Sequence:CCGGCGCCCAAACTGAGAGATAAGACTCGAGTCTTATCTCTCAGTTTGGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004579
VALIDATED
MAP4K2 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004579.2-2728s1c1
Sequence:CCGGCCGACGCCTCTGCAATAACTGCTCGAGCAGTTATTGCAGAGGCGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004579.2-2670s1c1
Sequence:CCGGGCTGAAGGTCAGAAGTAATCCCTCGAGGGATTACTTCTGACCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004579.2-1083s1c1
Sequence:CCGGCAGTTTCACCAGGTGAAATTTCTCGAGAAATTTCACCTGGTGAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004579.2-537s1c1
Sequence:CCGGGATGTCAAACTGGCTGACTTTCTCGAGAAAGTCAGCCAGTTTGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.2-1505s1c1
Sequence:CCGGCGCCTGCTTCTCCAAGGTCTTCTCGAGAAGACCTTGGAGAAGCAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-387s1c1
Sequence:CCGGCAGGAGATTTACCATGCCACTCTCGAGAGTGGCATGGTAAATCTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-2303s1c1
Sequence:CCGGACCTGAGCTGACCTTTGATTTCTCGAGAAATCAAAGGTCAGCTCAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-850s1c1
Sequence:CCGGCCCTGACCAAGAATCCTAAGACTCGAGTCTTAGGATTCTTGGTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004579.x-2909s1c1
Sequence:CCGGCGGTATTTAAGAGAGAACTATCTCGAGATAGTTCTCTCTTAAATACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-790s1c1
Sequence:CCGGCGCCCAAACTGAGAGATAAGACTCGAGTCTTATCTCTCAGTTTGGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004579
VALIDATED
MAP4K2 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004579.2-2728s1c1
Sequence:CCGGCCGACGCCTCTGCAATAACTGCTCGAGCAGTTATTGCAGAGGCGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004579.2-2670s1c1
Sequence:CCGGGCTGAAGGTCAGAAGTAATCCCTCGAGGGATTACTTCTGACCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004579.2-1083s1c1
Sequence:CCGGCAGTTTCACCAGGTGAAATTTCTCGAGAAATTTCACCTGGTGAAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004579.2-537s1c1
Sequence:CCGGGATGTCAAACTGGCTGACTTTCTCGAGAAAGTCAGCCAGTTTGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.2-1505s1c1
Sequence:CCGGCGCCTGCTTCTCCAAGGTCTTCTCGAGAAGACCTTGGAGAAGCAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-387s1c1
Sequence:CCGGCAGGAGATTTACCATGCCACTCTCGAGAGTGGCATGGTAAATCTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-2303s1c1
Sequence:CCGGACCTGAGCTGACCTTTGATTTCTCGAGAAATCAAAGGTCAGCTCAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-850s1c1
Sequence:CCGGCCCTGACCAAGAATCCTAAGACTCGAGTCTTAGGATTCTTGGTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004579.x-2909s1c1
Sequence:CCGGCGGTATTTAAGAGAGAACTATCTCGAGATAGTTCTCTCTTAAATACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004579.x-790s1c1
Sequence:CCGGCGCCCAAACTGAGAGATAAGACTCGAGTCTTATCTCTCAGTTTGGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)