EMAIL THIS PAGE TO A FRIEND

MAP4K3

mitogen-activated protein kinase kinase kinase kinase 3

251 Gene Product Result for
Synonyms: GLK MAPKKKK3 MEKKK 3 MEKKK3 RAB8IPL1
UniProtKB ID: Q8IVH8, Q6IQ39, Q8IVH7, Q9UDM5, Q9Y6R5
Gene ID:
Human(8491) Summary: This gene encodes a member of the mitogen-activated protein kinase kinase kinase kinase family. The encoded protein activates key effectors in cell signalling, among them c-Jun. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(225028) mitogen-activated protein kinase kinase kinase kinase 3
Rat(170920) mitogen-activated protein kinase kinase kinase kinase 3
chicken(425965) mitogen-activated protein kinase kinase kinase kinase 3
cow(507624) mitogen-activated protein kinase kinase kinase kinase 3
Horse(100069835) mitogen-activated protein kinase kinase kinase kinase 3
domestic cat(101098622) mitogen-activated protein kinase kinase kinase kinase 3
dog(475734) mitogen-activated protein kinase kinase kinase kinase 3
sheep(101118350) mitogen-activated protein kinase kinase kinase kinase 3
domestic guinea pig(100716179) mitogen-activated protein kinase kinase kinase kinase 3
naked mole-rat(101709571) mitogen-activated protein kinase kinase kinase kinase 3
Domestic Rabbit(100356354) mitogen-activated protein kinase kinase kinase kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_128800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071911 MISSION® esiRNA esiRNA human MAP4K3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003618 Rosetta Predictions human pricing
XM_001055154 Rosetta Predictions rat pricing
XM_001057874 Rosetta Predictions rat pricing
XM_001057927 Rosetta Predictions rat pricing
XM_343006 Rosetta Predictions rat pricing
NM_001081357 Rosetta Predictions mouse pricing
XM_128800 Rosetta Predictions mouse pricing
XM_898819 Rosetta Predictions mouse pricing
XM_898825 Rosetta Predictions mouse pricing
XM_898830 Rosetta Predictions mouse pricing
XM_898838 Rosetta Predictions mouse pricing
XM_898848 Rosetta Predictions mouse pricing
XM_898852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335960 predicted 1828
2 SASI_Hs01_00040140 predicted 2621
3 SASI_Hs01_00040142 predicted 318
4 SASI_Hs01_00040143 predicted 2236
5 SASI_Hs01_00040144 predicted 577
6 SASI_Hs02_00335961 predicted 1092
7 SASI_Hs01_00040145 predicted 1660
8 SASI_Hs01_00040146 predicted 691
9 SASI_Hs01_00040148 predicted 974
10 SASI_Hs02_00335962 predicted 1796
11 SASI_Hs01_00040139 predicted 2155
12 SASI_Hs01_00040141 predicted 961
13 SASI_Hs01_00040147 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278636 predicted 624
2 SASI_Rn02_00278637 predicted 1497
3 SASI_Rn02_00278638 predicted 2243
4 SASI_Rn02_00278639 predicted 430
5 SASI_Rn02_00278640 predicted 2724
6 SASI_Rn02_00278641 predicted 571
7 SASI_Rn02_00278642 predicted 408
8 SASI_Rn02_00278643 predicted 682
9 SASI_Rn02_00278644 predicted 603
10 SASI_Rn02_00278645 predicted 2663
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287796 predicted 622
2 SASI_Rn02_00287797 predicted 1562
3 SASI_Rn02_00287798 predicted 2310
4 SASI_Rn02_00287799 predicted 435
5 SASI_Rn02_00287800 predicted 1289
6 SASI_Rn02_00287801 predicted 2788
7 SASI_Rn02_00287802 predicted 569
8 SASI_Rn02_00287803 predicted 685
9 SASI_Rn02_00287804 predicted 607
10 SASI_Rn02_00287805 predicted 2730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288003 predicted 627
2 SASI_Rn02_00288004 predicted 1501
3 SASI_Rn02_00288005 predicted 2248
4 SASI_Rn02_00288006 predicted 435
5 SASI_Rn02_00288007 predicted 2720
6 SASI_Rn02_00288008 predicted 569
7 SASI_Rn02_00288009 predicted 406
8 SASI_Rn02_00288010 predicted 688
9 SASI_Rn02_00288011 predicted 603
10 SASI_Rn02_00288012 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395181 predicted 620
2 SASI_Rn02_00395182 predicted 1555
3 SASI_Rn02_00395183 predicted 2314
4 SASI_Rn02_00395184 predicted 427
5 SASI_Rn02_00395185 predicted 1292
6 SASI_Rn02_00395186 predicted 2787
7 SASI_Rn02_00395187 predicted 568
8 SASI_Rn02_00395188 predicted 688
9 SASI_Rn02_00395189 predicted 602
10 SASI_Rn02_00395190 predicted 2727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297621 predicted 2733
2 SASI_Mm02_00297622 predicted 2170
3 SASI_Mm02_00297623 predicted 2791
4 SASI_Mm02_00297624 predicted 568
5 SASI_Mm02_00297625 predicted 428
6 SASI_Mm02_00297626 predicted 1542
7 SASI_Mm02_00297627 predicted 691
8 SASI_Mm02_00297628 predicted 1309
9 SASI_Mm02_00297629 predicted 608
10 SASI_Mm02_00297630 predicted 2813
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241507 predicted 2736
2 SASI_Mm01_00241508 predicted 2175
3 SASI_Mm01_00241509 predicted 2795
4 SASI_Mm01_00241510 predicted 581
5 SASI_Mm01_00241511 predicted 434
6 SASI_Mm01_00241512 predicted 420
7 SASI_Mm01_00241513 predicted 1552
8 SASI_Mm01_00241514 predicted 688
9 SASI_Mm01_00241515 predicted 1309
10 SASI_Mm01_00241516 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279402 predicted 2674
2 SASI_Mm01_00279403 predicted 2110
3 SASI_Mm01_00279404 predicted 2734
4 SASI_Mm01_00279405 predicted 573
5 SASI_Mm01_00279406 predicted 438
6 SASI_Mm01_00279407 predicted 412
7 SASI_Mm01_00279408 predicted 1481
8 SASI_Mm01_00279409 predicted 694
9 SASI_Mm01_00279410 predicted 565
10 SASI_Mm01_00279411 predicted 2748
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206349 predicted 244
2 SASI_Mm01_00206350 predicted 256
3 SASI_Mm01_00206351 predicted 259
4 SASI_Mm01_00206352 predicted 330
5 SASI_Mm01_00206353 predicted 263
6 SASI_Mm01_00206354 predicted 327
7 SASI_Mm01_00206355 predicted 331
8 SASI_Mm01_00206356 predicted 254
9 SASI_Mm01_00206357 predicted 322
10 SASI_Mm01_00206358 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228087 predicted 228
2 SASI_Mm01_00228088 predicted 205
3 SASI_Mm01_00228089 predicted 323
4 SASI_Mm01_00228090 predicted 214
5 SASI_Mm01_00228091 predicted 304
6 SASI_Mm01_00228092 predicted 273
7 SASI_Mm01_00228093 predicted 216
8 SASI_Mm01_00228094 predicted 248
9 SASI_Mm01_00228095 predicted 167
10 SASI_Mm01_00228096 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276230 predicted 2823
2 SASI_Mm01_00276231 predicted 2264
3 SASI_Mm01_00276232 predicted 2884
4 SASI_Mm01_00276233 predicted 1637
5 SASI_Mm01_00276234 predicted 2410
6 SASI_Mm01_00276235 predicted 2906
7 SASI_Mm01_00276236 predicted 3063
8 SASI_Mm01_00276237 predicted 2836
9 SASI_Mm01_00276238 predicted 1655
10 SASI_Mm01_00276239 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217926 predicted 2743
2 SASI_Mm01_00217927 predicted 2180
3 SASI_Mm01_00217928 predicted 2799
4 SASI_Mm01_00217929 predicted 574
5 SASI_Mm01_00217930 predicted 433
6 SASI_Mm01_00217931 predicted 418
7 SASI_Mm01_00217932 predicted 1548
8 SASI_Mm01_00217933 predicted 691
9 SASI_Mm01_00217934 predicted 1317
10 SASI_Mm01_00217935 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261395 predicted 2619
2 SASI_Mm01_00261396 predicted 2062
3 SASI_Mm01_00261397 predicted 2670
4 SASI_Mm01_00261398 predicted 1348
5 SASI_Mm01_00261399 predicted 575
6 SASI_Mm01_00261400 predicted 434
7 SASI_Mm01_00261401 predicted 417
8 SASI_Mm01_00261402 predicted 1429
9 SASI_Mm01_00261403 predicted 688
10 SASI_Mm01_00261404 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003618
VALIDATED
MAP4K3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 3
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.x-3038s1c1
Sequence:CCGGCTGAAGACATACACTAAGAATCTCGAGATTCTTAGTGTATGTCTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.x-1824s1c1
Sequence:CCGGGTGCCGAAGAAGGGATTTATACTCGAGTATAAATCCCTTCTTCGGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.x-2250s1c1
Sequence:CCGGGTCCACTTAGAATGTTTGAAACTCGAGTTTCAAACATTCTAAGTGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-1669s21c1
Sequence:CCGGAGATGTACCAAAGCCTATTAGCTCGAGCTAATAGGCTTTGGTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003618.x-965s1c1
Sequence:CCGGCCAGATCATTCCACTTACCATCTCGAGATGGTAAGTGGAATGATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003618.x-1396s1c1
Sequence:CCGGGCCACCAAAGCCTAAGTCTATCTCGAGATAGACTTAGGCTTTGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-513s21c1
Sequence:GTACCGGACATTCTATTAACGGATAATGCTCGAGCATTATCCGTTAATAGAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003618.2-2959s21c1
Sequence:GTACCGGGAACCACACAAGTGCTTAATTCTCGAGAATTAAGCACTTGTGTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003618.2-2545s1c1
Sequence:CCGGCCAGATTGAATCAATAGTGTGCTCGAGCACACTATTGATTCAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-299s1c1
Sequence:CCGGCACCCAAATATTGTTGCTTATCTCGAGATAAGCAACAATATTTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-3525s1c1
Sequence:CCGGCCTGTAAGATTGCTTGTCTTTCTCGAGAAAGACAAGCAATCTTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-1771s1c1
Sequence:CCGGCTGTGCATCATCATGGATAAACTCGAGTTTATCCATGATGATGCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-3336s1c1
Sequence:CCGGGCAAGTACACTGGTGTTTATACTCGAGTATAAACACCAGTGTACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-2250s21c1
Sequence:CCGGGTCCACTTAGAATGTTTGAAACTCGAGTTTCAAACATTCTAAGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003618.2-2346s21c1
Sequence:CCGGTTCGATTTGAGACGGTCAATCCTCGAGGATTGACCGTCTCAAATCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003618.2-3170s21c1
Sequence:CCGGATTCTTGGGTGTGGCTATATTCTCGAGAATATAGCCACACCCAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-1187s21c1
Sequence:CCGGTACTACACTGCAAGATCTAATCTCGAGATTAGATCTTGCAGTGTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-1923s21c1
Sequence:GTACCGGACAATTGCTTGCTATCAATATCTCGAGATATTGATAGCAAGCAATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003618
VALIDATED
MAP4K3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 3
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.x-3038s1c1
Sequence:CCGGCTGAAGACATACACTAAGAATCTCGAGATTCTTAGTGTATGTCTTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.x-1824s1c1
Sequence:CCGGGTGCCGAAGAAGGGATTTATACTCGAGTATAAATCCCTTCTTCGGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.x-2250s1c1
Sequence:CCGGGTCCACTTAGAATGTTTGAAACTCGAGTTTCAAACATTCTAAGTGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-1669s21c1
Sequence:CCGGAGATGTACCAAAGCCTATTAGCTCGAGCTAATAGGCTTTGGTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003618.x-965s1c1
Sequence:CCGGCCAGATCATTCCACTTACCATCTCGAGATGGTAAGTGGAATGATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003618.x-1396s1c1
Sequence:CCGGGCCACCAAAGCCTAAGTCTATCTCGAGATAGACTTAGGCTTTGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-513s21c1
Sequence:GTACCGGACATTCTATTAACGGATAATGCTCGAGCATTATCCGTTAATAGAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003618.2-2959s21c1
Sequence:GTACCGGGAACCACACAAGTGCTTAATTCTCGAGAATTAAGCACTTGTGTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003618.2-2545s1c1
Sequence:CCGGCCAGATTGAATCAATAGTGTGCTCGAGCACACTATTGATTCAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-299s1c1
Sequence:CCGGCACCCAAATATTGTTGCTTATCTCGAGATAAGCAACAATATTTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-3525s1c1
Sequence:CCGGCCTGTAAGATTGCTTGTCTTTCTCGAGAAAGACAAGCAATCTTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-1771s1c1
Sequence:CCGGCTGTGCATCATCATGGATAAACTCGAGTTTATCCATGATGATGCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-3336s1c1
Sequence:CCGGGCAAGTACACTGGTGTTTATACTCGAGTATAAACACCAGTGTACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-2250s21c1
Sequence:CCGGGTCCACTTAGAATGTTTGAAACTCGAGTTTCAAACATTCTAAGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003618.2-2346s21c1
Sequence:CCGGTTCGATTTGAGACGGTCAATCCTCGAGGATTGACCGTCTCAAATCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003618.2-3170s21c1
Sequence:CCGGATTCTTGGGTGTGGCTATATTCTCGAGAATATAGCCACACCCAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-1187s21c1
Sequence:CCGGTACTACACTGCAAGATCTAATCTCGAGATTAGATCTTGCAGTGTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-1923s21c1
Sequence:GTACCGGACAATTGCTTGCTATCAATATCTCGAGATATTGATAGCAAGCAATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003618
VALIDATED
MAP4K3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 3
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.x-3038s1c1
Sequence:CCGGCTGAAGACATACACTAAGAATCTCGAGATTCTTAGTGTATGTCTTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.x-1824s1c1
Sequence:CCGGGTGCCGAAGAAGGGATTTATACTCGAGTATAAATCCCTTCTTCGGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.x-2250s1c1
Sequence:CCGGGTCCACTTAGAATGTTTGAAACTCGAGTTTCAAACATTCTAAGTGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-1669s21c1
Sequence:CCGGAGATGTACCAAAGCCTATTAGCTCGAGCTAATAGGCTTTGGTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003618.x-965s1c1
Sequence:CCGGCCAGATCATTCCACTTACCATCTCGAGATGGTAAGTGGAATGATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003618.x-1396s1c1
Sequence:CCGGGCCACCAAAGCCTAAGTCTATCTCGAGATAGACTTAGGCTTTGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-513s21c1
Sequence:GTACCGGACATTCTATTAACGGATAATGCTCGAGCATTATCCGTTAATAGAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003618.2-2959s21c1
Sequence:GTACCGGGAACCACACAAGTGCTTAATTCTCGAGAATTAAGCACTTGTGTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003618.2-2545s1c1
Sequence:CCGGCCAGATTGAATCAATAGTGTGCTCGAGCACACTATTGATTCAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-299s1c1
Sequence:CCGGCACCCAAATATTGTTGCTTATCTCGAGATAAGCAACAATATTTGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-3525s1c1
Sequence:CCGGCCTGTAAGATTGCTTGTCTTTCTCGAGAAAGACAAGCAATCTTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-1771s1c1
Sequence:CCGGCTGTGCATCATCATGGATAAACTCGAGTTTATCCATGATGATGCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003618.2-3336s1c1
Sequence:CCGGGCAAGTACACTGGTGTTTATACTCGAGTATAAACACCAGTGTACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-2250s21c1
Sequence:CCGGGTCCACTTAGAATGTTTGAAACTCGAGTTTCAAACATTCTAAGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003618.2-2346s21c1
Sequence:CCGGTTCGATTTGAGACGGTCAATCCTCGAGGATTGACCGTCTCAAATCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003618.2-3170s21c1
Sequence:CCGGATTCTTGGGTGTGGCTATATTCTCGAGAATATAGCCACACCCAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-1187s21c1
Sequence:CCGGTACTACACTGCAAGATCTAATCTCGAGATTAGATCTTGCAGTGTAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003618.2-1923s21c1
Sequence:GTACCGGACAATTGCTTGCTATCAATATCTCGAGATATTGATAGCAAGCAATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081357
VALIDATED
MAP4K3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000339119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081357.1-1300s21c1
Sequence:CCGGTACTACACTGCAAGATCTAATCTCGAGATTAGATCTTGCAGTGTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081357.1-1432s21c1
Sequence:CCGGGCACACTTAGAAGATGACGAACTCGAGTTCGTCATCTTCTAAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081357.1-1786s21c1
Sequence:CCGGGTCCCGAAACCAATTAGTAATCTCGAGATTACTAATTGGTTTCGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081357.1-304s21c1
Sequence:CCGGCGGAATGTCAACACTGGAGAACTCGAGTTCTCCAGTGTTGACATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081357
VALIDATED
MAP4K3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000339119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081357.1-1300s21c1
Sequence:CCGGTACTACACTGCAAGATCTAATCTCGAGATTAGATCTTGCAGTGTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081357.1-1432s21c1
Sequence:CCGGGCACACTTAGAAGATGACGAACTCGAGTTCGTCATCTTCTAAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081357.1-1786s21c1
Sequence:CCGGGTCCCGAAACCAATTAGTAATCTCGAGATTACTAATTGGTTTCGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081357.1-304s21c1
Sequence:CCGGCGGAATGTCAACACTGGAGAACTCGAGTTCTCCAGTGTTGACATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081357
VALIDATED
MAP4K3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000339119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081357.1-1300s21c1
Sequence:CCGGTACTACACTGCAAGATCTAATCTCGAGATTAGATCTTGCAGTGTAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081357.1-1432s21c1
Sequence:CCGGGCACACTTAGAAGATGACGAACTCGAGTTCGTCATCTTCTAAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081357.1-1786s21c1
Sequence:CCGGGTCCCGAAACCAATTAGTAATCTCGAGATTACTAATTGGTTTCGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081357.1-304s21c1
Sequence:CCGGCGGAATGTCAACACTGGAGAACTCGAGTTCTCCAGTGTTGACATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128800
VALIDATED
MAP4K3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128800.4-527s1c1
Sequence:CCGGCCGAGATATAAAGGGCGCTAACTCGAGTTAGCGCCCTTTATATCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_128800.4-2756s1c1
Sequence:CCGGCCCAACAGCAAATAGCAATTTCTCGAGAAATTGCTATTTGCTGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128800.4-1706s1c1
Sequence:CCGGCGTCCCGAAACCAATTAGTAACTCGAGTTACTAATTGGTTTCGGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128800.4-225s1c1
Sequence:CCGGCGGAATGTCAACACTGGAGAACTCGAGTTCTCCAGTGTTGACATTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_128800.4-1353s1c1
Sequence:CCGGGCACACTTAGAAGATGACGAACTCGAGTTCGTCATCTTCTAAGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128800
VALIDATED
MAP4K3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128800.4-527s1c1
Sequence:CCGGCCGAGATATAAAGGGCGCTAACTCGAGTTAGCGCCCTTTATATCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_128800.4-2756s1c1
Sequence:CCGGCCCAACAGCAAATAGCAATTTCTCGAGAAATTGCTATTTGCTGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128800.4-1706s1c1
Sequence:CCGGCGTCCCGAAACCAATTAGTAACTCGAGTTACTAATTGGTTTCGGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128800.4-225s1c1
Sequence:CCGGCGGAATGTCAACACTGGAGAACTCGAGTTCTCCAGTGTTGACATTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_128800.4-1353s1c1
Sequence:CCGGGCACACTTAGAAGATGACGAACTCGAGTTCGTCATCTTCTAAGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128800
VALIDATED
MAP4K3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128800.4-527s1c1
Sequence:CCGGCCGAGATATAAAGGGCGCTAACTCGAGTTAGCGCCCTTTATATCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_128800.4-2756s1c1
Sequence:CCGGCCCAACAGCAAATAGCAATTTCTCGAGAAATTGCTATTTGCTGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128800.4-1706s1c1
Sequence:CCGGCGTCCCGAAACCAATTAGTAACTCGAGTTACTAATTGGTTTCGGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128800.4-225s1c1
Sequence:CCGGCGGAATGTCAACACTGGAGAACTCGAGTTCTCCAGTGTTGACATTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_128800.4-1353s1c1
Sequence:CCGGGCACACTTAGAAGATGACGAACTCGAGTTCGTCATCTTCTAAGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)