EMAIL THIS PAGE TO A FRIEND

MAP4K4

mitogen-activated protein kinase kinase kinase kinase 4

217 Gene Product Result for
Synonyms: FLH21957 HGK MEKKK4 NIK
UniProtKB ID: O95819, O75172, Q9NST7
Gene ID:
Human(9448) Summary: The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(26921) mitogen-activated protein kinase kinase kinase kinase 4
Rat(301363) mitogen-activated protein kinase kinase kinase kinase 4
chicken(418714) mitogen-activated protein kinase kinase kinase kinase 4
cow(509109) mitogen-activated protein kinase kinase kinase kinase 4
domestic cat(101081214) mitogen-activated protein kinase kinase kinase kinase 4
dog(481331) mitogen-activated protein kinase kinase kinase kinase 4
naked mole-rat(101707800) mitogen-activated protein kinase kinase kinase kinase 4
domestic guinea pig(100723651) mitogen-activated protein kinase kinase kinase kinase 4
sheep(101109789) mitogen-activated protein kinase kinase kinase kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412472 ANTI-MAP4K4 antibody produced in mouse clone 4F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412473 ANTI-MAP4K4 antibody produced in mouse clone 3D9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412474 ANTI-MAP4K4 antibody produced in mouse clone 3B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA008476 Anti-MAP4K4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5500141 Anti-MAP4K4 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP177, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB2103939 Anti-MAP4K4, (N-terminal) antibody produced in rabbit affinity isolated antibody pig, bovine, zebrafish, rabbit, horse, human, rat, mouse, guinea pig
immunohistochemistry, western blot pricing
SAB4503649 Anti-MEKKK 4 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, western blot pricing
SAB1302477 ANTI-MOUSE MAP4K4 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB1306052 ANTI-NIK(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
WH0009448M7 Monoclonal Anti-MAP4K4 antibody produced in mouse clone 4A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404720 Monoclonal Anti-MAP4K4 antibody produced in mouse clone 2D4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300431 Monoclonal Anti-MAP4K4 antibody produced in mouse clone 4H9E7, ascites fluid human
ELISA, western blot pricing
SAB5300432 Monoclonal Anti-MAP4K4 antibody produced in mouse clone 3C7B5, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU076381 MISSION® esiRNA esiRNA targeting mouse Map4k4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004834 Rosetta Predictions human pricing
NM_145686 Rosetta Predictions human pricing
NM_145687 Rosetta Predictions human pricing
NM_001106904 Rosetta Predictions rat pricing
NM_008696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119578 predicted 711
2 SASI_Hs02_00338407 predicted 945
3 SASI_Hs01_00119580 predicted 2691
4 SASI_Hs01_00119581 predicted 2475
5 SASI_Hs01_00119582 predicted 936
6 SASI_Hs01_00119583 predicted 1918
7 SASI_Hs01_00119584 predicted 2779
8 SASI_Hs01_00119585 predicted 2578
9 SASI_Hs01_00119586 predicted 2262
10 SASI_Hs02_00338408 predicted 2251
11 SASI_Hs01_00119579 predicted 2341
12 SASI_Hs01_00119587 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137631 predicted 704
2 SASI_Hs02_00365288 predicted 941
3 SASI_Hs01_00137633 predicted 3176
4 SASI_Hs01_00137634 predicted 2962
5 SASI_Hs01_00137635 predicted 943
6 SASI_Hs01_00137636 predicted 2395
7 SASI_Hs01_00137637 predicted 3265
8 SASI_Hs01_00137638 predicted 3060
9 SASI_Hs01_00137639 predicted 2748
10 SASI_Hs02_00365289 predicted 2738
11 SASI_Hs01_00137632 predicted 2820
12 SASI_Hs01_00137640 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021510 predicted 712
2 SASI_Hs02_00365290 predicted 949
3 SASI_Hs01_00021512 predicted 2846
4 SASI_Hs01_00021513 predicted 2639
5 SASI_Hs01_00021514 predicted 938
6 SASI_Hs01_00021515 predicted 2073
7 SASI_Hs01_00021516 predicted 2944
8 SASI_Hs01_00021517 predicted 2743
9 SASI_Hs01_00021518 predicted 2423
10 SASI_Hs02_00365291 predicted 2411
11 SASI_Hs01_00021511 predicted 2505
12 SASI_Hs01_00021519 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223546 predicted 3105
2 SASI_Rn02_00223547 predicted 3136
3 SASI_Rn02_00223548 predicted 1866
4 SASI_Rn02_00223549 predicted 3019
5 SASI_Rn02_00223550 predicted 2120
6 SASI_Rn02_00223551 predicted 2593
7 SASI_Rn02_00223552 predicted 2361
8 SASI_Rn02_00223553 predicted 331
9 SASI_Rn02_00223554 predicted 1786
10 SASI_Rn02_00223555 predicted 3226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131839 predicted 3482
2 SASI_Mm01_00131840 predicted 3507
3 SASI_Mm01_00131841 predicted 563
4 SASI_Mm02_00314510 predicted 417
5 SASI_Mm01_00131842 predicted 754
6 SASI_Mm01_00131843 predicted 3628
7 SASI_Mm02_00314511 predicted 471
8 SASI_Mm01_00131844 predicted 2968
9 SASI_Mm01_00131846 predicted 3789
10 SASI_Mm01_00131847 predicted 3276
11 SASI_Mm01_00131845 predicted 1838
12 SASI_Mm01_00131848 predicted 3240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145687
VALIDATED
MAP4K4 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145687.1-3708s1c1
Sequence:CCGGCAGGGATTACTGGCCTCCAGACTCGAGTCTGGAGGCCAGTAATCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.1-290s1c1
Sequence:CCGGCACAGAAACATTGCAACATATCTCGAGATATGTTGCAATGTTTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.1-3458s1c1
Sequence:CCGGCCTACATCAGTAGCATATATTCTCGAGAATATATGCTACTGATGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145687.x-2945s1c1
Sequence:CCGGGTCTACTATTTGTCCTGGTTACTCGAGTAACCAGGACAAATAGTAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_145687.x-998s1c1
Sequence:CCGGGAGAAAGATGAAACTGAGTATCTCGAGATACTCAGTTTCATCTTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_145687.x-3839s1c1
Sequence:CCGGTCCTTCCTGTTCCTCTTATATCTCGAGATATAAGAGGAACAGGAAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145687.x-1661s1c1
Sequence:CCGGCGAGAGGTGGAAGATAGATTTCTCGAGAAATCTATCTTCCACCTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.2-3163s1c1
Sequence:CCGGATTTGGAGAATTGGTACATAACTCGAGTTATGTACCAATTCTCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.2-157s1c1
Sequence:CCGGCACCTATGGACAAGTCTATAACTCGAGTTATAGACTTGTCCATAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145687
VALIDATED
MAP4K4 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145687.1-3708s1c1
Sequence:CCGGCAGGGATTACTGGCCTCCAGACTCGAGTCTGGAGGCCAGTAATCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.1-290s1c1
Sequence:CCGGCACAGAAACATTGCAACATATCTCGAGATATGTTGCAATGTTTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.1-3458s1c1
Sequence:CCGGCCTACATCAGTAGCATATATTCTCGAGAATATATGCTACTGATGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145687.x-2945s1c1
Sequence:CCGGGTCTACTATTTGTCCTGGTTACTCGAGTAACCAGGACAAATAGTAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_145687.x-998s1c1
Sequence:CCGGGAGAAAGATGAAACTGAGTATCTCGAGATACTCAGTTTCATCTTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_145687.x-3839s1c1
Sequence:CCGGTCCTTCCTGTTCCTCTTATATCTCGAGATATAAGAGGAACAGGAAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145687.x-1661s1c1
Sequence:CCGGCGAGAGGTGGAAGATAGATTTCTCGAGAAATCTATCTTCCACCTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.2-3163s1c1
Sequence:CCGGATTTGGAGAATTGGTACATAACTCGAGTTATGTACCAATTCTCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.2-157s1c1
Sequence:CCGGCACCTATGGACAAGTCTATAACTCGAGTTATAGACTTGTCCATAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145687
VALIDATED
MAP4K4 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145687.1-3708s1c1
Sequence:CCGGCAGGGATTACTGGCCTCCAGACTCGAGTCTGGAGGCCAGTAATCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.1-290s1c1
Sequence:CCGGCACAGAAACATTGCAACATATCTCGAGATATGTTGCAATGTTTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.1-3458s1c1
Sequence:CCGGCCTACATCAGTAGCATATATTCTCGAGAATATATGCTACTGATGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145687.x-2945s1c1
Sequence:CCGGGTCTACTATTTGTCCTGGTTACTCGAGTAACCAGGACAAATAGTAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_145687.x-998s1c1
Sequence:CCGGGAGAAAGATGAAACTGAGTATCTCGAGATACTCAGTTTCATCTTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_145687.x-3839s1c1
Sequence:CCGGTCCTTCCTGTTCCTCTTATATCTCGAGATATAAGAGGAACAGGAAGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145687.x-1661s1c1
Sequence:CCGGCGAGAGGTGGAAGATAGATTTCTCGAGAAATCTATCTTCCACCTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.2-3163s1c1
Sequence:CCGGATTTGGAGAATTGGTACATAACTCGAGTTATGTACCAATTCTCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145687.2-157s1c1
Sequence:CCGGCACCTATGGACAAGTCTATAACTCGAGTTATAGACTTGTCCATAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008696
VALIDATED
MAP4K4 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-2152s1c1
Sequence:CCGGCCTGACGATAAGAAAGAAGTACTCGAGTACTTCTTTCTTATCGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-101s1c1
Sequence:CCGGGCACCTATGGACAAGTCTATACTCGAGTATAGACTTGTCCATAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-3160s1c1
Sequence:CCGGGCCTTTAAGTCATTTGGAGAACTCGAGTTCTCCAAATGACTTAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-2906s1c1
Sequence:CCGGGCCTAAATGTCCTGGTGACAACTCGAGTTGTCACCAGGACATTTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-2472s21c1
Sequence:CCGGCCTGACGATAAGAAAGAAGTACTCGAGTACTTCTTTCTTATCGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008696.2-4496s21c1
Sequence:CCGGAGAAGCAGAGAACAGATTTAACTCGAGTTAAATCTGTTCTCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-3785s21c1
Sequence:CCGGGCCGACATCTGTAGCATATATCTCGAGATATATGCTACAGATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-568s21c1
Sequence:CCGGCGTACTATGGTGCTTTCATTACTCGAGTAATGAAAGCACCATAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-418s21c1
Sequence:CCGGGCACCTATGGACAAGTCTATACTCGAGTATAGACTTGTCCATAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008696
VALIDATED
MAP4K4 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-2152s1c1
Sequence:CCGGCCTGACGATAAGAAAGAAGTACTCGAGTACTTCTTTCTTATCGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-101s1c1
Sequence:CCGGGCACCTATGGACAAGTCTATACTCGAGTATAGACTTGTCCATAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-3160s1c1
Sequence:CCGGGCCTTTAAGTCATTTGGAGAACTCGAGTTCTCCAAATGACTTAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-2906s1c1
Sequence:CCGGGCCTAAATGTCCTGGTGACAACTCGAGTTGTCACCAGGACATTTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-2472s21c1
Sequence:CCGGCCTGACGATAAGAAAGAAGTACTCGAGTACTTCTTTCTTATCGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008696.2-4496s21c1
Sequence:CCGGAGAAGCAGAGAACAGATTTAACTCGAGTTAAATCTGTTCTCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-3785s21c1
Sequence:CCGGGCCGACATCTGTAGCATATATCTCGAGATATATGCTACAGATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-568s21c1
Sequence:CCGGCGTACTATGGTGCTTTCATTACTCGAGTAATGAAAGCACCATAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-418s21c1
Sequence:CCGGGCACCTATGGACAAGTCTATACTCGAGTATAGACTTGTCCATAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008696
VALIDATED
MAP4K4 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-2152s1c1
Sequence:CCGGCCTGACGATAAGAAAGAAGTACTCGAGTACTTCTTTCTTATCGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-101s1c1
Sequence:CCGGGCACCTATGGACAAGTCTATACTCGAGTATAGACTTGTCCATAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-3160s1c1
Sequence:CCGGGCCTTTAAGTCATTTGGAGAACTCGAGTTCTCCAAATGACTTAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008696.1-2906s1c1
Sequence:CCGGGCCTAAATGTCCTGGTGACAACTCGAGTTGTCACCAGGACATTTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-2472s21c1
Sequence:CCGGCCTGACGATAAGAAAGAAGTACTCGAGTACTTCTTTCTTATCGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008696.2-4496s21c1
Sequence:CCGGAGAAGCAGAGAACAGATTTAACTCGAGTTAAATCTGTTCTCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-3785s21c1
Sequence:CCGGGCCGACATCTGTAGCATATATCTCGAGATATATGCTACAGATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-568s21c1
Sequence:CCGGCGTACTATGGTGCTTTCATTACTCGAGTAATGAAAGCACCATAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008696.2-418s21c1
Sequence:CCGGGCACCTATGGACAAGTCTATACTCGAGTATAGACTTGTCCATAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)