EMAIL THIS PAGE TO A FRIEND

MAP4K5

mitogen-activated protein kinase kinase kinase kinase 5

184 Gene Product Result for
Synonyms: GCKR KHS KHS1 MAPKKKK5
UniProtKB ID: Q9Y4K4, Q8IYF6
Gene ID:
Human(11183) Summary: This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(399510) mitogen-activated protein kinase kinase kinase kinase 5
Rat(503027) mitogen-activated protein kinase kinase kinase kinase 5
sheep(101103818) mitogen-activated protein kinase kinase kinase kinase 5
domestic guinea pig(100727959) mitogen-activated protein kinase kinase kinase kinase 5
naked mole-rat(101697393) mitogen-activated protein kinase kinase kinase kinase 5
Domestic Rabbit(100346909) mitogen-activated protein kinase kinase kinase kinase 5
Zebrafish(334565) mitogen-activated protein kinase kinase kinase kinase 5
cow(781335) mitogen-activated protein kinase kinase kinase kinase 5
Horse(100066454) mitogen-activated protein kinase kinase kinase kinase 5
domestic cat(101095501) mitogen-activated protein kinase kinase kinase kinase 5
dog(490685) mitogen-activated protein kinase kinase kinase kinase 5
chicken(423576) mitogen-activated protein kinase kinase kinase kinase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006575 Rosetta Predictions human pricing
NM_198794 Rosetta Predictions human pricing
XM_001076790 Rosetta Predictions rat pricing
XM_578547 Rosetta Predictions rat pricing
NM_024275 Rosetta Predictions mouse pricing
NM_201519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057677 predicted 2591
2 SASI_Hs01_00057678 predicted 2485
3 SASI_Hs01_00057679 predicted 1917
4 SASI_Hs01_00057681 predicted 1954
5 SASI_Hs01_00057682 predicted 2115
6 SASI_Hs01_00057684 predicted 632
7 SASI_Hs01_00057685 predicted 2409
8 SASI_Hs01_00057686 predicted 2705
9 SASI_Hs02_00341864 predicted 1378
10 SASI_Hs02_00341865 predicted 2819
11 SASI_Hs01_00057680 predicted 597
12 SASI_Hs01_00057683 predicted 2354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161869 predicted 2638
2 SASI_Hs01_00161870 predicted 2534
3 SASI_Hs01_00161871 predicted 1967
4 SASI_Hs01_00161873 predicted 2002
5 SASI_Hs01_00161874 predicted 2160
6 SASI_Hs01_00161876 predicted 677
7 SASI_Hs01_00161877 predicted 2456
8 SASI_Hs01_00161878 predicted 2759
9 SASI_Hs02_00372322 predicted 1428
10 SASI_Hs02_00372323 predicted 2871
11 SASI_Hs01_00161872 predicted 646
12 SASI_Hs01_00161875 predicted 2404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354586 predicted 1329
2 SASI_Rn02_00354587 predicted 620
3 SASI_Rn02_00354588 predicted 1246
4 SASI_Rn02_00354589 predicted 1729
5 SASI_Rn02_00354590 predicted 2583
6 SASI_Rn02_00354591 predicted 559
7 SASI_Rn02_00354592 predicted 1128
8 SASI_Rn02_00354593 predicted 1813
9 SASI_Rn02_00354594 predicted 2054
10 SASI_Rn02_00354595 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408097 predicted 1320
2 SASI_Rn02_00408098 predicted 624
3 SASI_Rn02_00408099 predicted 1246
4 SASI_Rn02_00408100 predicted 1726
5 SASI_Rn02_00408101 predicted 2582
6 SASI_Rn02_00408102 predicted 558
7 SASI_Rn02_00408103 predicted 1124
8 SASI_Rn02_00408104 predicted 1815
9 SASI_Rn02_00408105 predicted 2052
10 SASI_Rn02_00408106 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041674 predicted 557
2 SASI_Mm01_00041675 predicted 1947
3 SASI_Mm01_00041676 predicted 2386
4 SASI_Mm01_00041677 predicted 1471
5 SASI_Mm01_00041678 predicted 535
6 SASI_Mm01_00041679 predicted 3039
7 SASI_Mm01_00041680 predicted 2802
8 SASI_Mm01_00041681 predicted 1021
9 SASI_Mm01_00041682 predicted 1006
10 SASI_Mm01_00041683 predicted 1547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351594 predicted 2196
2 SASI_Mm01_00194429 predicted 547
3 SASI_Mm01_00194430 predicted 1947
4 SASI_Mm01_00194431 predicted 2379
5 SASI_Mm01_00194432 predicted 1461
6 SASI_Mm01_00194433 predicted 524
7 SASI_Mm01_00194435 predicted 2791
8 SASI_Mm01_00194436 predicted 1025
9 SASI_Mm01_00194437 predicted 999
10 SASI_Mm01_00194438 predicted 1541
11 SASI_Mm01_00194434 predicted 3046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201519
MAP4K5 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201519.2-2130s21c1
Sequence:CCGGTCTACTCTCACAACCTTATTGCTCGAGCAATAAGGTTGTGAGAGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201519.2-3148s21c1
Sequence:CCGGGTGGTGGTTATATCAAGTTTGCTCGAGCAAACTTGATATAACCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201519.2-721s21c1
Sequence:CCGGTCACGTGACTGGGCCATTATCCTCGAGGATAATGGCCCAGTCACGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201519.2-3115s21c1
Sequence:CCGGGCTGGAAACAGCTAGTCAATCCTCGAGGATTGACTAGCTGTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201519.2-1987s21c1
Sequence:CCGGTGGAACTGAAGATGGTATTTACTCGAGTAAATACCATCTTCAGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201519
MAP4K5 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201519.2-2130s21c1
Sequence:CCGGTCTACTCTCACAACCTTATTGCTCGAGCAATAAGGTTGTGAGAGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201519.2-3148s21c1
Sequence:CCGGGTGGTGGTTATATCAAGTTTGCTCGAGCAAACTTGATATAACCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201519.2-721s21c1
Sequence:CCGGTCACGTGACTGGGCCATTATCCTCGAGGATAATGGCCCAGTCACGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201519.2-3115s21c1
Sequence:CCGGGCTGGAAACAGCTAGTCAATCCTCGAGGATTGACTAGCTGTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201519.2-1987s21c1
Sequence:CCGGTGGAACTGAAGATGGTATTTACTCGAGTAAATACCATCTTCAGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201519
MAP4K5 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201519.2-2130s21c1
Sequence:CCGGTCTACTCTCACAACCTTATTGCTCGAGCAATAAGGTTGTGAGAGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201519.2-3148s21c1
Sequence:CCGGGTGGTGGTTATATCAAGTTTGCTCGAGCAAACTTGATATAACCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201519.2-721s21c1
Sequence:CCGGTCACGTGACTGGGCCATTATCCTCGAGGATAATGGCCCAGTCACGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201519.2-3115s21c1
Sequence:CCGGGCTGGAAACAGCTAGTCAATCCTCGAGGATTGACTAGCTGTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201519.2-1987s21c1
Sequence:CCGGTGGAACTGAAGATGGTATTTACTCGAGTAAATACCATCTTCAGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024275
VALIDATED
MAP4K5 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024275.1-2577s1c1
Sequence:CCGGGCTTCAAATCAGATGAGGTTACTCGAGTAACCTCATCTGATTTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024275.1-1826s1c1
Sequence:CCGGGCAACTATGGAACAGTTATTTCTCGAGAAATAACTGTTCCATAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024275.1-632s1c1
Sequence:CCGGCTTGCCTACTTGCATACTAAACTCGAGTTTAGTATGCAAGTAGGCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024275.1-1131s1c1
Sequence:CCGGCCCACGCAATCATTCGTCATACTCGAGTATGACGAATGATTGCGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024275.1-2070s1c1
Sequence:CCGGGCTGCATAGTTAGAAACCCTTCTCGAGAAGGGTTTCTAACTATGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024275
VALIDATED
MAP4K5 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024275.1-2577s1c1
Sequence:CCGGGCTTCAAATCAGATGAGGTTACTCGAGTAACCTCATCTGATTTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024275.1-1826s1c1
Sequence:CCGGGCAACTATGGAACAGTTATTTCTCGAGAAATAACTGTTCCATAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024275.1-632s1c1
Sequence:CCGGCTTGCCTACTTGCATACTAAACTCGAGTTTAGTATGCAAGTAGGCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024275.1-1131s1c1
Sequence:CCGGCCCACGCAATCATTCGTCATACTCGAGTATGACGAATGATTGCGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024275.1-2070s1c1
Sequence:CCGGGCTGCATAGTTAGAAACCCTTCTCGAGAAGGGTTTCTAACTATGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024275
VALIDATED
MAP4K5 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024275.1-2577s1c1
Sequence:CCGGGCTTCAAATCAGATGAGGTTACTCGAGTAACCTCATCTGATTTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024275.1-1826s1c1
Sequence:CCGGGCAACTATGGAACAGTTATTTCTCGAGAAATAACTGTTCCATAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024275.1-632s1c1
Sequence:CCGGCTTGCCTACTTGCATACTAAACTCGAGTTTAGTATGCAAGTAGGCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024275.1-1131s1c1
Sequence:CCGGCCCACGCAATCATTCGTCATACTCGAGTATGACGAATGATTGCGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024275.1-2070s1c1
Sequence:CCGGGCTGCATAGTTAGAAACCCTTCTCGAGAAGGGTTTCTAACTATGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006575
MAP4K5 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase kinase 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-965s1c1
Sequence:CCGGGCCACCTATGTTTGATCTCCACTCGAGTGGAGATCAAACATAGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-2826s1c1
Sequence:CCGGCTCTACATCTTGGCTGGACATCTCGAGATGTCCAGCCAAGATGTAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-2158s1c1
Sequence:CCGGCAACAAAGATTCCTGATACAACTCGAGTTGTATCAGGAATCTTTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-1196s1c1
Sequence:CCGGCAAAGTGAACAATCCAGATAACTCGAGTTATCTGGATTGTTCACTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006575.3-3045s1c1
Sequence:CCGGGCCACTGTGTGGTGGTTATATCTCGAGATATAACCACCACACAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006575.3-544s1c1
Sequence:CCGGGTAACATCGTTGCCTACTTTGCTCGAGCAAAGTAGGCAACGATGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006575.3-3020s1c1
Sequence:CCGGGCTGGAAACAGCTAGTCTATCCTCGAGGATAGACTAGCTGTTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006575.3-3924s1c1
Sequence:CCGGCCTGATGGGATAGTATCAATACTCGAGTATTGATACTATCCCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006575.3-702s1c1
Sequence:CCGGCTTGCCTATTTGCATACTAAACTCGAGTTTAGTATGCAAATAGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.3-417s1c1
Sequence:CCGGGACGTCTATAAGGCCAGAAATCTCGAGATTTCTGGCCTTATAGACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006575.3-2089s1c1
Sequence:CCGGCAGGATTAGCTGCCCATATTCCTCGAGGAATATGGGCAGCTAATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006575.3-3643s1c1
Sequence:CCGGGCTGTGTCTACCATGTGTATGCTCGAGCATACACATGGTAGACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.3-764s1c1
Sequence:CCGGGACAGACCATGGCGATGTAAACTCGAGTTTACATCGCCATGGTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006575
MAP4K5 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase kinase 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-965s1c1
Sequence:CCGGGCCACCTATGTTTGATCTCCACTCGAGTGGAGATCAAACATAGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-2826s1c1
Sequence:CCGGCTCTACATCTTGGCTGGACATCTCGAGATGTCCAGCCAAGATGTAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-2158s1c1
Sequence:CCGGCAACAAAGATTCCTGATACAACTCGAGTTGTATCAGGAATCTTTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-1196s1c1
Sequence:CCGGCAAAGTGAACAATCCAGATAACTCGAGTTATCTGGATTGTTCACTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006575.3-3045s1c1
Sequence:CCGGGCCACTGTGTGGTGGTTATATCTCGAGATATAACCACCACACAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006575.3-544s1c1
Sequence:CCGGGTAACATCGTTGCCTACTTTGCTCGAGCAAAGTAGGCAACGATGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006575.3-3020s1c1
Sequence:CCGGGCTGGAAACAGCTAGTCTATCCTCGAGGATAGACTAGCTGTTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006575.3-3924s1c1
Sequence:CCGGCCTGATGGGATAGTATCAATACTCGAGTATTGATACTATCCCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006575.3-702s1c1
Sequence:CCGGCTTGCCTATTTGCATACTAAACTCGAGTTTAGTATGCAAATAGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.3-417s1c1
Sequence:CCGGGACGTCTATAAGGCCAGAAATCTCGAGATTTCTGGCCTTATAGACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006575.3-2089s1c1
Sequence:CCGGCAGGATTAGCTGCCCATATTCCTCGAGGAATATGGGCAGCTAATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006575.3-3643s1c1
Sequence:CCGGGCTGTGTCTACCATGTGTATGCTCGAGCATACACATGGTAGACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.3-764s1c1
Sequence:CCGGGACAGACCATGGCGATGTAAACTCGAGTTTACATCGCCATGGTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006575
MAP4K5 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase kinase 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-965s1c1
Sequence:CCGGGCCACCTATGTTTGATCTCCACTCGAGTGGAGATCAAACATAGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-2826s1c1
Sequence:CCGGCTCTACATCTTGGCTGGACATCTCGAGATGTCCAGCCAAGATGTAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-2158s1c1
Sequence:CCGGCAACAAAGATTCCTGATACAACTCGAGTTGTATCAGGAATCTTTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.x-1196s1c1
Sequence:CCGGCAAAGTGAACAATCCAGATAACTCGAGTTATCTGGATTGTTCACTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006575.3-3045s1c1
Sequence:CCGGGCCACTGTGTGGTGGTTATATCTCGAGATATAACCACCACACAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006575.3-544s1c1
Sequence:CCGGGTAACATCGTTGCCTACTTTGCTCGAGCAAAGTAGGCAACGATGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006575.3-3020s1c1
Sequence:CCGGGCTGGAAACAGCTAGTCTATCCTCGAGGATAGACTAGCTGTTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006575.3-3924s1c1
Sequence:CCGGCCTGATGGGATAGTATCAATACTCGAGTATTGATACTATCCCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006575.3-702s1c1
Sequence:CCGGCTTGCCTATTTGCATACTAAACTCGAGTTTAGTATGCAAATAGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.3-417s1c1
Sequence:CCGGGACGTCTATAAGGCCAGAAATCTCGAGATTTCTGGCCTTATAGACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006575.3-2089s1c1
Sequence:CCGGCAGGATTAGCTGCCCATATTCCTCGAGGAATATGGGCAGCTAATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006575.3-3643s1c1
Sequence:CCGGGCTGTGTCTACCATGTGTATGCTCGAGCATACACATGGTAGACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006575.3-764s1c1
Sequence:CCGGGACAGACCATGGCGATGTAAACTCGAGTTTACATCGCCATGGTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)