EMAIL THIS PAGE TO A FRIEND

MAP6

microtubule-associated protein 6

138 Gene Product Result for
Synonyms: MTAP6 N-STOP STOP
UniProtKB ID: Q96JE9, A7E2A1, Q6P3T0
Gene ID:
Human(4135) Summary: This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(17760) microtubule-associated protein 6
Rat(29457) microtubule-associated protein 6
Zebrafish(100000844) microtubule-associated protein 6
chicken(395753) microtubule-associated protein 6
cow(518794) microtubule-associated protein 6
Horse(100064475) microtubule-associated protein 6
domestic cat(101100588) microtubule-associated protein 6
dog(476803) microtubule-associated protein 6
naked mole-rat(101699657) microtubule-associated protein 6
sheep(101109480) microtubule-associated protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207577 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_166256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166256 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033063 Rosetta Predictions human pricing
NM_207577 Rosetta Predictions human pricing
NM_017204 Rosetta Predictions rat pricing
XM_579399 Rosetta Predictions rat pricing
NM_001043355 Rosetta Predictions mouse pricing
NM_001048167 Rosetta Predictions mouse pricing
NM_010837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106916 predicted 1150
2 SASI_Hs01_00106917 predicted 1039
3 SASI_Hs01_00106918 predicted 985
4 SASI_Hs01_00106919 predicted 1100
5 SASI_Hs02_00360762 predicted 1154
6 SASI_Hs01_00106920 predicted 953
7 SASI_Hs02_00360763 predicted 990
8 SASI_Hs01_00106922 predicted 1066
9 SASI_Hs01_00106923 predicted 993
10 SASI_Hs01_00106924 predicted 991
11 SASI_Hs01_00106921 predicted 993
12 SASI_Hs01_00106925 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222506 predicted 1150
2 SASI_Hs01_00222507 predicted 1038
3 SASI_Hs01_00222508 predicted 986
4 SASI_Hs01_00222509 predicted 1102
5 SASI_Hs02_00374151 predicted 1150
6 SASI_Hs01_00222510 predicted 953
7 SASI_Hs02_00374152 predicted 982
8 SASI_Hs01_00222512 predicted 1059
9 SASI_Hs01_00222513 predicted 993
10 SASI_Hs01_00222514 predicted 988
11 SASI_Hs01_00222511 predicted 990
12 SASI_Hs01_00222515 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121264 predicted 2290
2 SASI_Rn01_00121265 predicted 1911
3 SASI_Rn01_00121266 predicted 3148
4 SASI_Rn01_00121267 predicted 2722
5 SASI_Rn01_00121268 predicted 1993
6 SASI_Rn01_00121270 predicted 1931
7 SASI_Rn01_00121271 predicted 2300
8 SASI_Rn01_00121272 predicted 2880
9 SASI_Rn02_00261564 predicted 2958
10 SASI_Rn02_00261565 predicted 2151
11 SASI_Rn01_00121269 predicted 1057
12 SASI_Rn01_00121273 predicted 2388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160569 predicted 1629
2 SASI_Rn01_00160570 predicted 1244
3 SASI_Rn01_00160571 predicted 2494
4 SASI_Rn01_00160572 predicted 2071
5 SASI_Rn01_00160573 predicted 1333
6 SASI_Rn01_00160574 predicted 400
7 SASI_Rn01_00160575 predicted 1270
8 SASI_Rn01_00160576 predicted 1638
9 SASI_Rn01_00160577 predicted 2217
10 SASI_Rn01_00160578 predicted 1725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291205 predicted 902
2 SASI_Mm02_00291206 predicted 398
3 SASI_Mm02_00291207 predicted 950
4 SASI_Mm02_00291208 predicted 952
5 SASI_Mm02_00291209 predicted 339
6 SASI_Mm02_00291210 predicted 480
7 SASI_Mm02_00291211 predicted 934
8 SASI_Mm02_00291212 predicted 547
9 SASI_Mm02_00291213 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292091 predicted 1806
2 SASI_Mm02_00292092 predicted 1112
3 SASI_Mm02_00292093 predicted 1299
4 SASI_Mm02_00292094 predicted 1856
5 SASI_Mm02_00292095 predicted 1854
6 SASI_Mm02_00292096 predicted 1240
7 SASI_Mm02_00292097 predicted 1517
8 SASI_Mm02_00292098 predicted 1837
9 SASI_Mm02_00292099 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319468 predicted 1806
2 SASI_Mm02_00319469 predicted 1106
3 SASI_Mm01_00105306 predicted 1299
4 SASI_Mm01_00105308 predicted 1857
5 SASI_Mm02_00319470 predicted 1849
6 SASI_Mm02_00319471 predicted 1516
7 SASI_Mm02_00319472 predicted 1840
8 SASI_Mm02_00319473 predicted 1445
9 SASI_Mm02_00319474 predicted 1840
10 SASI_Mm01_00105303 predicted 2755
11 SASI_Mm01_00105304 predicted 2507
12 SASI_Mm01_00105305 predicted 2819
13 SASI_Mm01_00105307 predicted 2607
14 SASI_Mm01_00105309 predicted 2876
15 SASI_Mm01_00105310 predicted 2007
16 SASI_Mm01_00105311 predicted 3011
17 SASI_Mm01_00105312 predicted 2643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207577
MAP6 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-1329s21c1
Sequence:CCGGGACGACAAGGAGCAAAGCAAACTCGAGTTTGCTTTGCTCCTTGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-1368s21c1
Sequence:CCGGGCTGAGGCGAAAGAGTAAATTCTCGAGAATTTACTCTTTCGCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-954s21c1
Sequence:CCGGGTGAGCAGCTCCTACAGGAATCTCGAGATTCCTGTAGGAGCTGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207577.1-1752s21c1
Sequence:CCGGATCTGTGTCACTGGTCGATTTCTCGAGAAATCGACCAGTGACACAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-1069s21c1
Sequence:CCGGGCTACAGTGCTCAGTTCAAAGCTCGAGCTTTGAACTGAGCACTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207577
MAP6 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-1329s21c1
Sequence:CCGGGACGACAAGGAGCAAAGCAAACTCGAGTTTGCTTTGCTCCTTGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-1368s21c1
Sequence:CCGGGCTGAGGCGAAAGAGTAAATTCTCGAGAATTTACTCTTTCGCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-954s21c1
Sequence:CCGGGTGAGCAGCTCCTACAGGAATCTCGAGATTCCTGTAGGAGCTGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207577.1-1752s21c1
Sequence:CCGGATCTGTGTCACTGGTCGATTTCTCGAGAAATCGACCAGTGACACAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-1069s21c1
Sequence:CCGGGCTACAGTGCTCAGTTCAAAGCTCGAGCTTTGAACTGAGCACTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207577
MAP6 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-1329s21c1
Sequence:CCGGGACGACAAGGAGCAAAGCAAACTCGAGTTTGCTTTGCTCCTTGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-1368s21c1
Sequence:CCGGGCTGAGGCGAAAGAGTAAATTCTCGAGAATTTACTCTTTCGCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-954s21c1
Sequence:CCGGGTGAGCAGCTCCTACAGGAATCTCGAGATTCCTGTAGGAGCTGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207577.1-1752s21c1
Sequence:CCGGATCTGTGTCACTGGTCGATTTCTCGAGAAATCGACCAGTGACACAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207577.1-1069s21c1
Sequence:CCGGGCTACAGTGCTCAGTTCAAAGCTCGAGCTTTGAACTGAGCACTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010837
VALIDATED
MAP6 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-2441s21c1
Sequence:CCGGTGTAGTCCCAGGGTCCTTAAACTCGAGTTTAAGGACCCTGGGACTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010837.3-2119s21c1
Sequence:CCGGAGACCTCAACGAGCCATAAACCTCGAGGTTTATGGCTCGTTGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010837.1-1651s1c1
Sequence:CCGGGACGACAAGGAGCAAAGCAAACTCGAGTTTGCTTTGCTCCTTGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010837.1-2077s1c1
Sequence:CCGGCCTCTGAAGAATCAGAGTCCTCTCGAGAGGACTCTGATTCTTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010837.1-1458s1c1
Sequence:CCGGCAGAAGAATACGGAGCCTCTACTCGAGTAGAGGCTCCGTATTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010837.1-2542s1c1
Sequence:CCGGGTACCTTTGAAGGGTCAGGATCTCGAGATCCTGACCCTTCAAAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010837.1-2498s1c1
Sequence:CCGGCTGTGGTTCTTGGGCCTATAACTCGAGTTATAGGCCCAAGAACCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-2681s21c1
Sequence:CCGGAGCAAGCACTAAGGATCAAAGCTCGAGCTTTGATCCTTAGTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-2871s21c1
Sequence:CCGGGCAGGCCCAGAGCTAGTTAAACTCGAGTTTAACTAGCTCTGGGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-3073s21c1
Sequence:CCGGCTGTGGTTCTTGGGCCTATAACTCGAGTTATAGGCCCAAGAACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010837
VALIDATED
MAP6 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-2441s21c1
Sequence:CCGGTGTAGTCCCAGGGTCCTTAAACTCGAGTTTAAGGACCCTGGGACTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010837.3-2119s21c1
Sequence:CCGGAGACCTCAACGAGCCATAAACCTCGAGGTTTATGGCTCGTTGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010837.1-1651s1c1
Sequence:CCGGGACGACAAGGAGCAAAGCAAACTCGAGTTTGCTTTGCTCCTTGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010837.1-2077s1c1
Sequence:CCGGCCTCTGAAGAATCAGAGTCCTCTCGAGAGGACTCTGATTCTTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010837.1-1458s1c1
Sequence:CCGGCAGAAGAATACGGAGCCTCTACTCGAGTAGAGGCTCCGTATTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010837.1-2542s1c1
Sequence:CCGGGTACCTTTGAAGGGTCAGGATCTCGAGATCCTGACCCTTCAAAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010837.1-2498s1c1
Sequence:CCGGCTGTGGTTCTTGGGCCTATAACTCGAGTTATAGGCCCAAGAACCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-2681s21c1
Sequence:CCGGAGCAAGCACTAAGGATCAAAGCTCGAGCTTTGATCCTTAGTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-2871s21c1
Sequence:CCGGGCAGGCCCAGAGCTAGTTAAACTCGAGTTTAACTAGCTCTGGGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-3073s21c1
Sequence:CCGGCTGTGGTTCTTGGGCCTATAACTCGAGTTATAGGCCCAAGAACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010837
VALIDATED
MAP6 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-2441s21c1
Sequence:CCGGTGTAGTCCCAGGGTCCTTAAACTCGAGTTTAAGGACCCTGGGACTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010837.3-2119s21c1
Sequence:CCGGAGACCTCAACGAGCCATAAACCTCGAGGTTTATGGCTCGTTGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010837.1-1651s1c1
Sequence:CCGGGACGACAAGGAGCAAAGCAAACTCGAGTTTGCTTTGCTCCTTGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010837.1-2077s1c1
Sequence:CCGGCCTCTGAAGAATCAGAGTCCTCTCGAGAGGACTCTGATTCTTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010837.1-1458s1c1
Sequence:CCGGCAGAAGAATACGGAGCCTCTACTCGAGTAGAGGCTCCGTATTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010837.1-2542s1c1
Sequence:CCGGGTACCTTTGAAGGGTCAGGATCTCGAGATCCTGACCCTTCAAAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010837.1-2498s1c1
Sequence:CCGGCTGTGGTTCTTGGGCCTATAACTCGAGTTATAGGCCCAAGAACCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-2681s21c1
Sequence:CCGGAGCAAGCACTAAGGATCAAAGCTCGAGCTTTGATCCTTAGTGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-2871s21c1
Sequence:CCGGGCAGGCCCAGAGCTAGTTAAACTCGAGTTTAACTAGCTCTGGGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010837.3-3073s21c1
Sequence:CCGGCTGTGGTTCTTGGGCCTATAACTCGAGTTATAGGCCCAAGAACCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166256
VALIDATED
MAP6 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166256.6-1041s1c1
Sequence:CCGGCCAGATGATAAGATGGTTCATCTCGAGATGAACCATCTTATCATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_166256.6-3117s1c1
Sequence:CCGGCGTGTTTATGAGTCACAGATTCTCGAGAATCTGTGACTCATAAACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166256.6-990s1c1
Sequence:CCGGACGGACATCAAGCCTGTGAAACTCGAGTTTCACAGGCTTGATGTCCGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166256.6-1194s1c1
Sequence:CCGGCCTAGTGTTCAGAGTTCCAAACTCGAGTTTGGAACTCTGAACACTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_166256.6-1113s1c1
Sequence:CCGGGCTGACAATAAGGTCATTGATCTCGAGATCAATGACCTTATTGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166256
VALIDATED
MAP6 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166256.6-1041s1c1
Sequence:CCGGCCAGATGATAAGATGGTTCATCTCGAGATGAACCATCTTATCATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_166256.6-3117s1c1
Sequence:CCGGCGTGTTTATGAGTCACAGATTCTCGAGAATCTGTGACTCATAAACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166256.6-990s1c1
Sequence:CCGGACGGACATCAAGCCTGTGAAACTCGAGTTTCACAGGCTTGATGTCCGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166256.6-1194s1c1
Sequence:CCGGCCTAGTGTTCAGAGTTCCAAACTCGAGTTTGGAACTCTGAACACTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_166256.6-1113s1c1
Sequence:CCGGGCTGACAATAAGGTCATTGATCTCGAGATCAATGACCTTATTGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166256
VALIDATED
MAP6 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166256.6-1041s1c1
Sequence:CCGGCCAGATGATAAGATGGTTCATCTCGAGATGAACCATCTTATCATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_166256.6-3117s1c1
Sequence:CCGGCGTGTTTATGAGTCACAGATTCTCGAGAATCTGTGACTCATAAACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166256.6-990s1c1
Sequence:CCGGACGGACATCAAGCCTGTGAAACTCGAGTTTCACAGGCTTGATGTCCGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166256.6-1194s1c1
Sequence:CCGGCCTAGTGTTCAGAGTTCCAAACTCGAGTTTGGAACTCTGAACACTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_166256.6-1113s1c1
Sequence:CCGGGCTGACAATAAGGTCATTGATCTCGAGATCAATGACCTTATTGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)