EMAIL THIS PAGE TO A FRIEND

MAP6D1

MAP6 domain containing 1

50 Gene Product Result for
Synonyms: MAPO6D1 SL21
UniProtKB ID: Q9H9H5
Gene ID:
Human(79929) Summary: This gene encodes a protein highly similar to the mouse MAP6 domain containing 1 protein, which is related to the STOP proteins. Based on the study of the mouse protein, the encoded protein may function as a calmodulin-regulated neuronal protein that binds and stabilizes microtubules but also associates with the Golgi membranes through N-terminal palmitoylation. [provided by RefSeq, Oct 2008]
Mouse(208158) MAP6 domain containing 1
Rat(363823) MAP6 domain containing 1
cow(614904) MAP6 domain containing 1
sheep(101109239) MAP6 domain containing 1
domestic guinea pig(100722294) MAP6 domain containing 1
naked mole-rat(101720106) MAP6 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024871 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024871 Rosetta Predictions human pricing
NM_001108844 Rosetta Predictions rat pricing
NM_198599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153941 predicted 618
2 SASI_Hs01_00153942 predicted 977
3 SASI_Hs01_00153944 predicted 636
4 SASI_Hs01_00153945 predicted 965
5 SASI_Hs01_00153947 predicted 844
6 SASI_Hs01_00153948 predicted 918
7 SASI_Hs01_00153949 predicted 1021
8 SASI_Hs01_00153950 predicted 1123
9 SASI_Hs02_00357462 predicted 979
10 SASI_Hs02_00357463 predicted 607
11 SASI_Hs01_00153943 predicted 1091
12 SASI_Hs01_00153946 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242635 predicted 319
2 SASI_Rn02_00242636 predicted 371
3 SASI_Rn02_00242637 predicted 209
4 SASI_Rn02_00242638 predicted 367
5 SASI_Rn02_00242639 predicted 358
6 SASI_Rn02_00242640 predicted 445
7 SASI_Rn02_00242641 predicted 514
8 SASI_Rn02_00242642 predicted 410
9 SASI_Rn02_00242643 predicted 386
10 SASI_Rn02_00242644 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031923 predicted 825
2 SASI_Mm01_00031926 predicted 398
3 SASI_Mm02_00350998 predicted 607
4 SASI_Mm01_00031927 predicted 1032
5 SASI_Mm01_00031928 predicted 826
6 SASI_Mm01_00031929 predicted 406
7 SASI_Mm01_00031930 predicted 589
8 SASI_Mm01_00031931 predicted 863
9 SASI_Mm01_00031932 predicted 422
10 SASI_Mm02_00350999 predicted 1006
11 SASI_Mm01_00031924 predicted 536
12 SASI_Mm01_00031925 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024871
MAP6D1 MISSION shRNA Bacterial Glycerol Stock
MAP6 domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-447s21c1
Sequence:CCGGCCACGTCGTACAGACAGGAATCTCGAGATTCCTGTCTGTACGACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-591s21c1
Sequence:CCGGGGAAGAAGTTCACTCCTAACCCTCGAGGGTTAGGAGTGAACTTCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-640s21c1
Sequence:CCGGCCGGATTCTCAACGTGTGACTCTCGAGAGTCACACGTTGAGAATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024871.2-1053s21c1
Sequence:CCGGATGCGTGAGCACTTGATTAATCTCGAGATTAATCAAGTGCTCACGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-522s21c1
Sequence:CCGGGAGTCATCACAACCCACACTTCTCGAGAAGTGTGGGTTGTGATGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-486s21c1
Sequence:CCGGTGAAGCCCTCAAGATCCACAACTCGAGTTGTGGATCTTGAGGGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024871.2-1008s21c1
Sequence:CCGGCCCTTGAAAGAACCAGTTATGCTCGAGCATAACTGGTTCTTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024871.1-464s1c1
Sequence:CCGGCCTCAAGATCCACAAAGACAACTCGAGTTGTCTTTGTGGATCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024871.1-1145s1c1
Sequence:CCGGGCTGAGTATCCAGGAGGAAATCTCGAGATTTCCTCCTGGATACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024871.1-559s1c1
Sequence:CCGGGTGAGGAAGAAGTTCACTCCTCTCGAGAGGAGTGAACTTCTTCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024871
MAP6D1 MISSION shRNA shRNA Plasmid DNA
MAP6 domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-447s21c1
Sequence:CCGGCCACGTCGTACAGACAGGAATCTCGAGATTCCTGTCTGTACGACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-591s21c1
Sequence:CCGGGGAAGAAGTTCACTCCTAACCCTCGAGGGTTAGGAGTGAACTTCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-640s21c1
Sequence:CCGGCCGGATTCTCAACGTGTGACTCTCGAGAGTCACACGTTGAGAATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024871.2-1053s21c1
Sequence:CCGGATGCGTGAGCACTTGATTAATCTCGAGATTAATCAAGTGCTCACGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-522s21c1
Sequence:CCGGGAGTCATCACAACCCACACTTCTCGAGAAGTGTGGGTTGTGATGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-486s21c1
Sequence:CCGGTGAAGCCCTCAAGATCCACAACTCGAGTTGTGGATCTTGAGGGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024871.2-1008s21c1
Sequence:CCGGCCCTTGAAAGAACCAGTTATGCTCGAGCATAACTGGTTCTTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024871.1-464s1c1
Sequence:CCGGCCTCAAGATCCACAAAGACAACTCGAGTTGTCTTTGTGGATCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024871.1-1145s1c1
Sequence:CCGGGCTGAGTATCCAGGAGGAAATCTCGAGATTTCCTCCTGGATACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024871.1-559s1c1
Sequence:CCGGGTGAGGAAGAAGTTCACTCCTCTCGAGAGGAGTGAACTTCTTCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024871
MAP6D1 MISSION shRNA Lentiviral Transduction Particles
MAP6 domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-447s21c1
Sequence:CCGGCCACGTCGTACAGACAGGAATCTCGAGATTCCTGTCTGTACGACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-591s21c1
Sequence:CCGGGGAAGAAGTTCACTCCTAACCCTCGAGGGTTAGGAGTGAACTTCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-640s21c1
Sequence:CCGGCCGGATTCTCAACGTGTGACTCTCGAGAGTCACACGTTGAGAATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024871.2-1053s21c1
Sequence:CCGGATGCGTGAGCACTTGATTAATCTCGAGATTAATCAAGTGCTCACGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-522s21c1
Sequence:CCGGGAGTCATCACAACCCACACTTCTCGAGAAGTGTGGGTTGTGATGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024871.2-486s21c1
Sequence:CCGGTGAAGCCCTCAAGATCCACAACTCGAGTTGTGGATCTTGAGGGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024871.2-1008s21c1
Sequence:CCGGCCCTTGAAAGAACCAGTTATGCTCGAGCATAACTGGTTCTTTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024871.1-464s1c1
Sequence:CCGGCCTCAAGATCCACAAAGACAACTCGAGTTGTCTTTGTGGATCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024871.1-1145s1c1
Sequence:CCGGGCTGAGTATCCAGGAGGAAATCTCGAGATTTCCTCCTGGATACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024871.1-559s1c1
Sequence:CCGGGTGAGGAAGAAGTTCACTCCTCTCGAGAGGAGTGAACTTCTTCCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198599
MAP6D1 MISSION shRNA Bacterial Glycerol Stock
MAP6 domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198599.1-366s1c1
Sequence:CCGGGTAGTAGCGACCACGTCTTATCTCGAGATAAGACGTGGTCGCTACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198599.1-421s1c1
Sequence:CCGGCCTCAAGATCCACAAAGGCAACTCGAGTTGCCTTTGTGGATCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198599.1-774s1c1
Sequence:CCGGGAGACTTTCTTGTCTTCTAAACTCGAGTTTAGAAGACAAGAAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198599.1-1044s1c1
Sequence:CCGGGCACATGCCTTTAATCCCAATCTCGAGATTGGGATTAAAGGCATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198599
MAP6D1 MISSION shRNA shRNA Plasmid DNA
MAP6 domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198599.1-366s1c1
Sequence:CCGGGTAGTAGCGACCACGTCTTATCTCGAGATAAGACGTGGTCGCTACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198599.1-421s1c1
Sequence:CCGGCCTCAAGATCCACAAAGGCAACTCGAGTTGCCTTTGTGGATCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198599.1-774s1c1
Sequence:CCGGGAGACTTTCTTGTCTTCTAAACTCGAGTTTAGAAGACAAGAAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198599.1-1044s1c1
Sequence:CCGGGCACATGCCTTTAATCCCAATCTCGAGATTGGGATTAAAGGCATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198599
MAP6D1 MISSION shRNA Lentiviral Transduction Particles
MAP6 domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198599.1-366s1c1
Sequence:CCGGGTAGTAGCGACCACGTCTTATCTCGAGATAAGACGTGGTCGCTACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198599.1-421s1c1
Sequence:CCGGCCTCAAGATCCACAAAGGCAACTCGAGTTGCCTTTGTGGATCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198599.1-774s1c1
Sequence:CCGGGAGACTTTCTTGTCTTCTAAACTCGAGTTTAGAAGACAAGAAAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198599.1-1044s1c1
Sequence:CCGGGCACATGCCTTTAATCCCAATCTCGAGATTGGGATTAAAGGCATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)