EMAIL THIS PAGE TO A FRIEND

MAP7

microtubule-associated protein 7

155 Gene Product Result for
Synonyms: E-MAP-115 EMAP115
Gene ID:
Human(9053) Summary: The product of this gene is a microtubule-associated protein that is predominantly expressed in cells of epithelial origin. Microtubule-associated proteins are thought to be involved in microtubule dynamics, which is essential for cell polarization and differentiation. This protein has been shown to be able to stabilize microtubules, and may serve to modulate microtubule functions. Studies of the related mouse protein also suggested an essential role in microtubule function required for spermatogenesis. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Mouse(17761) microtubule-associated protein 7
Rat(293016) microtubule-associated protein 7
naked mole-rat(101712619) microtubule-associated protein 7
domestic guinea pig(100722710) microtubule-associated protein 7
sheep(101112232) microtubule-associated protein 7
chicken(421689) microtubule-associated protein 7
cow(506766) microtubule-associated protein 7
Horse(100073181) microtubule-associated protein 7
domestic cat(101086061) microtubule-associated protein 7
dog(476214) microtubule-associated protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003980 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003980 Rosetta Predictions human pricing
NM_001106270 Rosetta Predictions rat pricing
NM_008635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336672 predicted 2077
2 SASI_Hs01_00066358 predicted 2547
3 SASI_Hs01_00066360 predicted 2220
4 SASI_Hs01_00066361 predicted 1226
5 SASI_Hs02_00336673 predicted 2515
6 SASI_Hs02_00336674 predicted 1178
7 SASI_Hs01_00066362 predicted 2342
8 SASI_Hs01_00066363 predicted 1017
9 SASI_Hs02_00336675 predicted 2343
10 SASI_Hs01_00066365 predicted 915
11 SASI_Hs01_00066357 predicted 2531
12 SASI_Hs01_00066359 predicted 2419
13 SASI_Hs01_00066364 predicted 2113
14 SASI_Hs01_00066366 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217318 predicted 1254
2 SASI_Rn02_00217319 predicted 1315
3 SASI_Rn02_00217320 predicted 1259
4 SASI_Rn02_00217321 predicted 1366
5 SASI_Rn02_00217322 predicted 1150
6 SASI_Rn02_00217323 predicted 1372
7 SASI_Rn02_00217324 predicted 581
8 SASI_Rn02_00217325 predicted 534
9 SASI_Rn02_00217326 predicted 1314
10 SASI_Rn02_00217327 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021703 predicted 2201
2 SASI_Mm01_00021704 predicted 2263
3 SASI_Mm02_00314355 predicted 1199
4 SASI_Mm01_00021705 predicted 870
5 SASI_Mm01_00021702 predicted 335
6 SASI_Mm01_00021706 predicted 1909
7 SASI_Mm01_00021708 predicted 1832
8 SASI_Mm01_00021709 predicted 2160
9 SASI_Mm01_00021710 predicted 1912
10 SASI_Mm01_00021711 predicted 1091
11 SASI_Mm01_00021707 predicted 1834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008635
VALIDATED
MAP7 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008635.1-2200s1c1
Sequence:CCGGCCTCCAAAGAACCAAAGCAAACTCGAGTTTGCTTTGGTTCTTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008635.1-67s1c1
Sequence:CCGGGCGTCTGATGGCTATAAAGTACTCGAGTACTTTATAGCCATCAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008635.1-1813s1c1
Sequence:CCGGGAGCAAAGAAATGGTGACATACTCGAGTATGTCACCATTTCTTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008635.1-602s1c1
Sequence:CCGGCCTCGTCTGCAACTTTGCTAACTCGAGTTAGCAAAGTTGCAGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008635.1-64s1c1
Sequence:CCGGCCAGCGTCTGATGGCTATAAACTCGAGTTTATAGCCATCAGACGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-696s21c1
Sequence:CCGGCCTCGTCTGCAACTTTGCTAACTCGAGTTAGCAAAGTTGCAGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-959s21c1
Sequence:CCGGCATGGACTAGCGAGCCATAAACTCGAGTTTATGGCTCGCTAGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008635.2-2720s21c1
Sequence:CCGGAGAGTGAGCGGAAGGTATTTACTCGAGTAAATACCTTCCGCTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-1876s21c1
Sequence:CCGGGAGGACAGAGACCGCTGATAACTCGAGTTATCAGCGGTCTCTGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-2009s21c1
Sequence:CCGGAGCCCACATGGAGTCGCTTTACTCGAGTAAAGCGACTCCATGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008635
VALIDATED
MAP7 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008635.1-2200s1c1
Sequence:CCGGCCTCCAAAGAACCAAAGCAAACTCGAGTTTGCTTTGGTTCTTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008635.1-67s1c1
Sequence:CCGGGCGTCTGATGGCTATAAAGTACTCGAGTACTTTATAGCCATCAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008635.1-1813s1c1
Sequence:CCGGGAGCAAAGAAATGGTGACATACTCGAGTATGTCACCATTTCTTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008635.1-602s1c1
Sequence:CCGGCCTCGTCTGCAACTTTGCTAACTCGAGTTAGCAAAGTTGCAGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008635.1-64s1c1
Sequence:CCGGCCAGCGTCTGATGGCTATAAACTCGAGTTTATAGCCATCAGACGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-696s21c1
Sequence:CCGGCCTCGTCTGCAACTTTGCTAACTCGAGTTAGCAAAGTTGCAGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-959s21c1
Sequence:CCGGCATGGACTAGCGAGCCATAAACTCGAGTTTATGGCTCGCTAGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008635.2-2720s21c1
Sequence:CCGGAGAGTGAGCGGAAGGTATTTACTCGAGTAAATACCTTCCGCTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-1876s21c1
Sequence:CCGGGAGGACAGAGACCGCTGATAACTCGAGTTATCAGCGGTCTCTGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-2009s21c1
Sequence:CCGGAGCCCACATGGAGTCGCTTTACTCGAGTAAAGCGACTCCATGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008635
VALIDATED
MAP7 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008635.1-2200s1c1
Sequence:CCGGCCTCCAAAGAACCAAAGCAAACTCGAGTTTGCTTTGGTTCTTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008635.1-67s1c1
Sequence:CCGGGCGTCTGATGGCTATAAAGTACTCGAGTACTTTATAGCCATCAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008635.1-1813s1c1
Sequence:CCGGGAGCAAAGAAATGGTGACATACTCGAGTATGTCACCATTTCTTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008635.1-602s1c1
Sequence:CCGGCCTCGTCTGCAACTTTGCTAACTCGAGTTAGCAAAGTTGCAGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008635.1-64s1c1
Sequence:CCGGCCAGCGTCTGATGGCTATAAACTCGAGTTTATAGCCATCAGACGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-696s21c1
Sequence:CCGGCCTCGTCTGCAACTTTGCTAACTCGAGTTAGCAAAGTTGCAGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-959s21c1
Sequence:CCGGCATGGACTAGCGAGCCATAAACTCGAGTTTATGGCTCGCTAGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008635.2-2720s21c1
Sequence:CCGGAGAGTGAGCGGAAGGTATTTACTCGAGTAAATACCTTCCGCTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-1876s21c1
Sequence:CCGGGAGGACAGAGACCGCTGATAACTCGAGTTATCAGCGGTCTCTGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008635.2-2009s21c1
Sequence:CCGGAGCCCACATGGAGTCGCTTTACTCGAGTAAAGCGACTCCATGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003980
VALIDATED
MAP7 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003980.3-3158s1c1
Sequence:CCGGGCCCTCTTACATAATGTATTTCTCGAGAAATACATTATGTAAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003980.3-1450s1c1
Sequence:CCGGGCACCTTTAGTGAAGGTAGAACTCGAGTTCTACCTTCACTAAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003980.3-2050s1c1
Sequence:CCGGCGACTTGAGGAGATTATGAAACTCGAGTTTCATAATCTCCTCAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003980.3-2386s1c1
Sequence:CCGGAGCCCAGAAATTCCTTTGAATCTCGAGATTCAAAGGAATTTCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003980.3-784s1c1
Sequence:CCGGCGGTCAGTTTCCACCATGAATCTCGAGATTCATGGTGGAAACTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-2336s21c1
Sequence:CCGGACTTACCCATTGGATCTAAACCTCGAGGTTTAGATCCAATGGGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-2050s21c1
Sequence:CCGGCGACTTGAGGAGATTATGAAACTCGAGTTTCATAATCTCCTCAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-784s21c1
Sequence:CCGGCGGTCAGTTTCCACCATGAATCTCGAGATTCATGGTGGAAACTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-906s21c1
Sequence:CCGGATGGGAGAGCAGCGTTGTTAACTCGAGTTAACAACGCTGCTCTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003980.3-2597s21c1
Sequence:CCGGTAGAGTTCTTGACCATCATTTCTCGAGAAATGATGGTCAAGAACTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003980
VALIDATED
MAP7 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003980.3-3158s1c1
Sequence:CCGGGCCCTCTTACATAATGTATTTCTCGAGAAATACATTATGTAAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003980.3-1450s1c1
Sequence:CCGGGCACCTTTAGTGAAGGTAGAACTCGAGTTCTACCTTCACTAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003980.3-2050s1c1
Sequence:CCGGCGACTTGAGGAGATTATGAAACTCGAGTTTCATAATCTCCTCAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003980.3-2386s1c1
Sequence:CCGGAGCCCAGAAATTCCTTTGAATCTCGAGATTCAAAGGAATTTCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003980.3-784s1c1
Sequence:CCGGCGGTCAGTTTCCACCATGAATCTCGAGATTCATGGTGGAAACTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-2336s21c1
Sequence:CCGGACTTACCCATTGGATCTAAACCTCGAGGTTTAGATCCAATGGGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-2050s21c1
Sequence:CCGGCGACTTGAGGAGATTATGAAACTCGAGTTTCATAATCTCCTCAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-784s21c1
Sequence:CCGGCGGTCAGTTTCCACCATGAATCTCGAGATTCATGGTGGAAACTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-906s21c1
Sequence:CCGGATGGGAGAGCAGCGTTGTTAACTCGAGTTAACAACGCTGCTCTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003980.3-2597s21c1
Sequence:CCGGTAGAGTTCTTGACCATCATTTCTCGAGAAATGATGGTCAAGAACTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003980
VALIDATED
MAP7 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003980.3-3158s1c1
Sequence:CCGGGCCCTCTTACATAATGTATTTCTCGAGAAATACATTATGTAAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003980.3-1450s1c1
Sequence:CCGGGCACCTTTAGTGAAGGTAGAACTCGAGTTCTACCTTCACTAAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003980.3-2050s1c1
Sequence:CCGGCGACTTGAGGAGATTATGAAACTCGAGTTTCATAATCTCCTCAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003980.3-2386s1c1
Sequence:CCGGAGCCCAGAAATTCCTTTGAATCTCGAGATTCAAAGGAATTTCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003980.3-784s1c1
Sequence:CCGGCGGTCAGTTTCCACCATGAATCTCGAGATTCATGGTGGAAACTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-2336s21c1
Sequence:CCGGACTTACCCATTGGATCTAAACCTCGAGGTTTAGATCCAATGGGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-2050s21c1
Sequence:CCGGCGACTTGAGGAGATTATGAAACTCGAGTTTCATAATCTCCTCAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-784s21c1
Sequence:CCGGCGGTCAGTTTCCACCATGAATCTCGAGATTCATGGTGGAAACTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003980.3-906s21c1
Sequence:CCGGATGGGAGAGCAGCGTTGTTAACTCGAGTTAACAACGCTGCTCTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003980.3-2597s21c1
Sequence:CCGGTAGAGTTCTTGACCATCATTTCTCGAGAAATGATGGTCAAGAACTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)