EMAIL THIS PAGE TO A FRIEND

MAP7D2

MAP7 domain containing 2

67 Gene Product Result for
Gene ID:
Mouse(78283) MAP7 domain containing 2
Rat(317508) MAP7 domain containing 2
chicken(418607) MAP7 domain containing 2
domestic cat(101082041) MAP7 domain containing 2
dog(491766) MAP7 domain containing 2
naked mole-rat(101719578) MAP7 domain containing 2
domestic guinea pig(100712727) MAP7 domain containing 2
sheep(101111160) MAP7 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152780 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_136135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152780 Rosetta Predictions human pricing
XM_001054594 Rosetta Predictions rat pricing
XM_228973 Rosetta Predictions rat pricing
NM_001081124 Rosetta Predictions mouse pricing
XM_136135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142345 predicted 2255
2 SASI_Hs01_00142346 predicted 1985
3 SASI_Hs01_00142347 predicted 2055
4 SASI_Hs01_00142348 predicted 2242
5 SASI_Hs01_00142349 predicted 508
6 SASI_Hs01_00142350 predicted 1949
7 SASI_Hs01_00142351 predicted 738
8 SASI_Hs01_00142353 predicted 1985
9 SASI_Hs01_00142354 predicted 566
10 SASI_Hs02_00366721 predicted 675
11 SASI_Hs01_00142352 predicted 2224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276380 predicted 1042
2 SASI_Rn02_00276381 predicted 1113
3 SASI_Rn02_00276382 predicted 2078
4 SASI_Rn02_00276383 predicted 768
5 SASI_Rn02_00276384 predicted 2184
6 SASI_Rn02_00276385 predicted 2364
7 SASI_Rn02_00276386 predicted 1978
8 SASI_Rn02_00276387 predicted 734
9 SASI_Rn02_00276388 predicted 385
10 SASI_Rn02_00276389 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385685 predicted 1049
2 SASI_Rn02_00385686 predicted 1107
3 SASI_Rn02_00385687 predicted 2079
4 SASI_Rn02_00385688 predicted 767
5 SASI_Rn02_00385689 predicted 2182
6 SASI_Rn02_00385690 predicted 2363
7 SASI_Rn02_00385691 predicted 1981
8 SASI_Rn02_00385692 predicted 730
9 SASI_Rn02_00385693 predicted 382
10 SASI_Rn02_00385694 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295421 predicted 2462
2 SASI_Mm02_00295422 predicted 2310
3 SASI_Mm02_00295423 predicted 2564
4 SASI_Mm02_00295424 predicted 2493
5 SASI_Mm02_00295425 predicted 2304
6 SASI_Mm02_00295426 predicted 2184
7 SASI_Mm02_00295427 predicted 879
8 SASI_Mm02_00295428 predicted 2198
9 SASI_Mm02_00295429 predicted 2011
10 SASI_Mm02_00295430 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_136135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261737 predicted 2205
2 SASI_Mm01_00261738 predicted 2317
3 SASI_Mm01_00261739 predicted 2562
4 SASI_Mm01_00261740 predicted 2491
5 SASI_Mm01_00261741 predicted 2309
6 SASI_Mm01_00261742 predicted 2187
7 SASI_Mm01_00261743 predicted 887
8 SASI_Mm01_00261744 predicted 2453
9 SASI_Mm01_00261745 predicted 2204
10 SASI_Mm01_00261746 predicted 2017
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152780
MAP7D2 MISSION shRNA Bacterial Glycerol Stock
MAP7 domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152780.2-2536s21c1
Sequence:CCGGGGCTCGGCAATTCGCTTTATACTCGAGTATAAAGCGAATTGCCGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152780.2-2355s21c1
Sequence:CCGGACTGTATTCCTAGGTAGTATGCTCGAGCATACTACCTAGGAATACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-897s21c1
Sequence:CCGGTATCCAAGACAGCTACTAAAGCTCGAGCTTTAGTAGCTGTCTTGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-582s21c1
Sequence:CCGGCCACCGTGGCAATATCCTATTCTCGAGAATAGGATATTGCCACGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-1988s21c1
Sequence:CCGGCTTATCTCTATCCCGGAATTTCTCGAGAAATTCCGGGATAGAGATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152780.2-2331s1c1
Sequence:CCGGCCCAAATTATTAGCTCGGAATCTCGAGATTCCGAGCTAATAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152780.2-1904s1c1
Sequence:CCGGGCCCTTGATGGGAAATCAAATCTCGAGATTTGATTTCCCATCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152780.2-728s1c1
Sequence:CCGGGCAGGAGATGTTGGGAAAGAACTCGAGTTCTTTCCCAACATCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152780.2-1987s1c1
Sequence:CCGGGCTTATCTCTATCCCGGAATTCTCGAGAATTCCGGGATAGAGATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-618s21c1
Sequence:CCGGTCCATGTCTGTCCTCGTTTAGCTCGAGCTAAACGAGGACAGACATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152780
MAP7D2 MISSION shRNA shRNA Plasmid DNA
MAP7 domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152780.2-2536s21c1
Sequence:CCGGGGCTCGGCAATTCGCTTTATACTCGAGTATAAAGCGAATTGCCGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152780.2-2355s21c1
Sequence:CCGGACTGTATTCCTAGGTAGTATGCTCGAGCATACTACCTAGGAATACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-897s21c1
Sequence:CCGGTATCCAAGACAGCTACTAAAGCTCGAGCTTTAGTAGCTGTCTTGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-582s21c1
Sequence:CCGGCCACCGTGGCAATATCCTATTCTCGAGAATAGGATATTGCCACGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-1988s21c1
Sequence:CCGGCTTATCTCTATCCCGGAATTTCTCGAGAAATTCCGGGATAGAGATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152780.2-2331s1c1
Sequence:CCGGCCCAAATTATTAGCTCGGAATCTCGAGATTCCGAGCTAATAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152780.2-1904s1c1
Sequence:CCGGGCCCTTGATGGGAAATCAAATCTCGAGATTTGATTTCCCATCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152780.2-728s1c1
Sequence:CCGGGCAGGAGATGTTGGGAAAGAACTCGAGTTCTTTCCCAACATCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152780.2-1987s1c1
Sequence:CCGGGCTTATCTCTATCCCGGAATTCTCGAGAATTCCGGGATAGAGATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-618s21c1
Sequence:CCGGTCCATGTCTGTCCTCGTTTAGCTCGAGCTAAACGAGGACAGACATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152780
MAP7D2 MISSION shRNA Lentiviral Transduction Particles
MAP7 domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152780.2-2536s21c1
Sequence:CCGGGGCTCGGCAATTCGCTTTATACTCGAGTATAAAGCGAATTGCCGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152780.2-2355s21c1
Sequence:CCGGACTGTATTCCTAGGTAGTATGCTCGAGCATACTACCTAGGAATACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-897s21c1
Sequence:CCGGTATCCAAGACAGCTACTAAAGCTCGAGCTTTAGTAGCTGTCTTGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-582s21c1
Sequence:CCGGCCACCGTGGCAATATCCTATTCTCGAGAATAGGATATTGCCACGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-1988s21c1
Sequence:CCGGCTTATCTCTATCCCGGAATTTCTCGAGAAATTCCGGGATAGAGATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152780.2-2331s1c1
Sequence:CCGGCCCAAATTATTAGCTCGGAATCTCGAGATTCCGAGCTAATAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152780.2-1904s1c1
Sequence:CCGGGCCCTTGATGGGAAATCAAATCTCGAGATTTGATTTCCCATCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152780.2-728s1c1
Sequence:CCGGGCAGGAGATGTTGGGAAAGAACTCGAGTTCTTTCCCAACATCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152780.2-1987s1c1
Sequence:CCGGGCTTATCTCTATCCCGGAATTCTCGAGAATTCCGGGATAGAGATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152780.2-618s21c1
Sequence:CCGGTCCATGTCTGTCCTCGTTTAGCTCGAGCTAAACGAGGACAGACATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136135
MAP7D2 MISSION shRNA Bacterial Glycerol Stock
MAP7 domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-1815s1c1
Sequence:CCGGGCTGCTAAACAGATGCGTTTACTCGAGTAAACGCATCTGTTTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-890s1c1
Sequence:CCGGCCCTCTCAAATCTTCATACAACTCGAGTTGTATGAAGATTTGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136135.3-3276s1c1
Sequence:CCGGCCTGCATTTGACTAACTGTAACTCGAGTTACAGTTAGTCAAATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-1607s1c1
Sequence:CCGGGCGCATAGAAATGGCCTATAACTCGAGTTATAGGCCATTTCTATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-1360s1c1
Sequence:CCGGCCGAGAAGTATGTAGCAGATACTCGAGTATCTGCTACATACTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136135
MAP7D2 MISSION shRNA shRNA Plasmid DNA
MAP7 domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-1815s1c1
Sequence:CCGGGCTGCTAAACAGATGCGTTTACTCGAGTAAACGCATCTGTTTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-890s1c1
Sequence:CCGGCCCTCTCAAATCTTCATACAACTCGAGTTGTATGAAGATTTGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136135.3-3276s1c1
Sequence:CCGGCCTGCATTTGACTAACTGTAACTCGAGTTACAGTTAGTCAAATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-1607s1c1
Sequence:CCGGGCGCATAGAAATGGCCTATAACTCGAGTTATAGGCCATTTCTATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-1360s1c1
Sequence:CCGGCCGAGAAGTATGTAGCAGATACTCGAGTATCTGCTACATACTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136135
MAP7D2 MISSION shRNA Lentiviral Transduction Particles
MAP7 domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-1815s1c1
Sequence:CCGGGCTGCTAAACAGATGCGTTTACTCGAGTAAACGCATCTGTTTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-890s1c1
Sequence:CCGGCCCTCTCAAATCTTCATACAACTCGAGTTGTATGAAGATTTGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136135.3-3276s1c1
Sequence:CCGGCCTGCATTTGACTAACTGTAACTCGAGTTACAGTTAGTCAAATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-1607s1c1
Sequence:CCGGGCGCATAGAAATGGCCTATAACTCGAGTTATAGGCCATTTCTATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136135.3-1360s1c1
Sequence:CCGGCCGAGAAGTATGTAGCAGATACTCGAGTATCTGCTACATACTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)