EMAIL THIS PAGE TO A FRIEND

MAP7D3

MAP7 domain containing 3

71 Gene Product Result for
Gene ID:
Human(79649) Summary: The protein encoded by this gene belongs to the MAP7 (microtubule-associated protein 7) family. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Mar 2010]
Rat(317614) MAP7 domain containing 3
Zebrafish(794500) MAP7 domain containing 3
chicken(422242) MAP7 domain containing 3
domestic cat(101082888) MAP7 domain containing 3
cow(506950) MAP7 domain containing 3
dog(481061) MAP7 domain containing 3
domestic guinea pig(100719848) MAP7 domain containing 3
naked mole-rat(101701687) MAP7 domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024597 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089711 MISSION® esiRNA esiRNA human MAP7D3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024597 Rosetta Predictions human pricing
XM_291344 Rosetta Predictions human pricing
XM_932162 Rosetta Predictions human pricing
XM_932166 Rosetta Predictions human pricing
XM_001058342 Rosetta Predictions rat pricing
XM_229202 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356938 predicted 803
2 SASI_Hs02_00356939 predicted 2532
3 SASI_Hs02_00356940 predicted 2260
4 SASI_Hs02_00356941 predicted 1828
5 SASI_Hs02_00356942 predicted 2764
6 SASI_Hs02_00356943 predicted 1621
7 SASI_Hs02_00356944 predicted 680
8 SASI_Hs02_00356945 predicted 657
9 SASI_Hs02_00356946 predicted 440
10 SASI_Hs02_00356947 predicted 2281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250816 predicted 628
2 SASI_Hs01_00250817 predicted 2355
3 SASI_Hs01_00250818 predicted 2086
4 SASI_Hs01_00250819 predicted 1642
5 SASI_Hs01_00250820 predicted 1441
6 SASI_Hs01_00250821 predicted 362
7 SASI_Hs01_00250822 predicted 2099
8 SASI_Hs01_00250823 predicted 1190
9 SASI_Hs01_00250824 predicted 2634
10 SASI_Hs01_00250825 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286085 predicted 937
2 SASI_Hs01_00286086 predicted 423
3 SASI_Hs01_00286087 predicted 659
4 SASI_Hs01_00286088 predicted 740
5 SASI_Hs01_00286089 predicted 1160
6 SASI_Hs01_00286090 predicted 598
7 SASI_Hs01_00286091 predicted 959
8 SASI_Hs01_00286092 predicted 765
9 SASI_Hs01_00286093 predicted 944
10 SASI_Hs01_00286094 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263206 predicted 2344
2 SASI_Hs01_00263207 predicted 2078
3 SASI_Hs01_00263208 predicted 1643
4 SASI_Hs01_00263209 predicted 2564
5 SASI_Hs01_00263210 predicted 1426
6 SASI_Hs01_00263211 predicted 608
7 SASI_Hs01_00263212 predicted 595
8 SASI_Hs01_00263213 predicted 902
9 SASI_Hs01_00263214 predicted 370
10 SASI_Hs01_00263215 predicted 2090
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289358 predicted 1470
2 SASI_Rn02_00289359 predicted 659
3 SASI_Rn02_00289360 predicted 1186
4 SASI_Rn02_00289361 predicted 2585
5 SASI_Rn02_00289362 predicted 314
6 SASI_Rn02_00289363 predicted 2615
7 SASI_Rn02_00289364 predicted 932
8 SASI_Rn02_00289365 predicted 1576
9 SASI_Rn02_00289366 predicted 703
10 SASI_Rn02_00289367 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148521 predicted 1097
2 SASI_Rn01_00148522 predicted 2201
3 SASI_Rn01_00148523 predicted 2232
4 SASI_Rn01_00148524 predicted 1070
5 SASI_Rn01_00148525 predicted 1192
6 SASI_Rn01_00148526 predicted 1777
7 SASI_Rn01_00148527 predicted 978
8 SASI_Rn01_00148528 predicted 1949
9 SASI_Rn01_00148529 predicted 973
10 SASI_Rn01_00148530 predicted 2209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024597
VALIDATED
MAP7D3 MISSION shRNA Bacterial Glycerol Stock
MAP7 domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024597.2-2294s21c1
Sequence:CCGGACATCCAGCCATGACATATATCTCGAGATATATGTCATGGCTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024597.2-862s21c1
Sequence:CCGGCACTGTACCCTTGCGTAAATGCTCGAGCATTTACGCAAGGGTACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024597.2-1659s21c1
Sequence:CCGGCATCACCATTACCACTTATTTCTCGAGAAATAAGTGGTAATGGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024597.2-1834s21c1
Sequence:CCGGCTATGAAGAGTCTGGTAATAACTCGAGTTATTACCAGACTCTTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024597.2-2847s21c1
Sequence:CCGGTCTGACTTGAACCTGGTAAAGCTCGAGCTTTACCAGGTTCAAGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024597
VALIDATED
MAP7D3 MISSION shRNA shRNA Plasmid DNA
MAP7 domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024597.2-2294s21c1
Sequence:CCGGACATCCAGCCATGACATATATCTCGAGATATATGTCATGGCTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024597.2-862s21c1
Sequence:CCGGCACTGTACCCTTGCGTAAATGCTCGAGCATTTACGCAAGGGTACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024597.2-1659s21c1
Sequence:CCGGCATCACCATTACCACTTATTTCTCGAGAAATAAGTGGTAATGGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024597.2-1834s21c1
Sequence:CCGGCTATGAAGAGTCTGGTAATAACTCGAGTTATTACCAGACTCTTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024597.2-2847s21c1
Sequence:CCGGTCTGACTTGAACCTGGTAAAGCTCGAGCTTTACCAGGTTCAAGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024597
VALIDATED
MAP7D3 MISSION shRNA Lentiviral Transduction Particles
MAP7 domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024597.2-2294s21c1
Sequence:CCGGACATCCAGCCATGACATATATCTCGAGATATATGTCATGGCTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024597.2-862s21c1
Sequence:CCGGCACTGTACCCTTGCGTAAATGCTCGAGCATTTACGCAAGGGTACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024597.2-1659s21c1
Sequence:CCGGCATCACCATTACCACTTATTTCTCGAGAAATAAGTGGTAATGGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024597.2-1834s21c1
Sequence:CCGGCTATGAAGAGTCTGGTAATAACTCGAGTTATTACCAGACTCTTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024597.2-2847s21c1
Sequence:CCGGTCTGACTTGAACCTGGTAAAGCTCGAGCTTTACCAGGTTCAAGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)