EMAIL THIS PAGE TO A FRIEND

MAP9

microtubule-associated protein 9

208 Gene Product Result for
Synonyms: ASAP
UniProtKB ID: Q49MG5, Q4W5I7, Q68DU1, Q9H781, Q9H7B6
Gene ID:
Human(79884) Summary: ASAP is a microtubule-associated protein required for spindle function, mitotic progression, and cytokinesis (Saffin et al., 2005 [PubMed 16049101]
Mouse(213582) microtubule-associated protein 9
Rat(310544) microtubule-associated protein 9
naked mole-rat(101713812) microtubule-associated protein 9
domestic guinea pig(100728560) microtubule-associated protein 9
sheep(101122383) microtubule-associated protein 9
Zebrafish(565974) microtubule-associated protein 9
cow(613821) microtubule-associated protein 9
Horse(100062089) microtubule-associated protein 9
domestic cat(101098626) microtubule-associated protein 9
dog(482662) microtubule-associated protein 9
chicken(422406) microtubule-associated protein 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024826 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039580 Rosetta Predictions human pricing
XM_001064348 Rosetta Predictions rat pricing
XM_227306 Rosetta Predictions rat pricing
NM_001081230 Rosetta Predictions mouse pricing
XM_485258 Rosetta Predictions mouse pricing
XM_898882 Rosetta Predictions mouse pricing
XM_898887 Rosetta Predictions mouse pricing
XM_898892 Rosetta Predictions mouse pricing
XM_993124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126175 predicted 1261
2 SASI_Hs02_00308580 predicted 1248
3 SASI_Hs01_00126176 predicted 342
4 SASI_Hs01_00126177 predicted 969
5 SASI_Hs01_00126178 predicted 1141
6 SASI_Hs02_00308581 predicted 1223
7 SASI_Hs02_00308582 predicted 860
8 SASI_Hs01_00126181 predicted 377
9 SASI_Hs02_00308583 predicted 1154
10 SASI_Hs02_00308584 predicted 1157
11 SASI_Hs01_00126174 predicted 870
12 SASI_Hs01_00126179 predicted 718
13 SASI_Hs01_00126180 predicted 1452
14 SASI_Hs01_00126182 predicted 1520
15 SASI_Hs01_00126183 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310111 predicted 1073
2 SASI_Rn02_00310112 predicted 227
3 SASI_Rn02_00310113 predicted 313
4 SASI_Rn02_00310114 predicted 1021
5 SASI_Rn02_00310115 predicted 203
6 SASI_Rn02_00310116 predicted 914
7 SASI_Rn02_00310117 predicted 475
8 SASI_Rn02_00310118 predicted 348
9 SASI_Rn02_00310119 predicted 229
10 SASI_Rn02_00310120 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384217 predicted 614
2 SASI_Rn02_00384218 predicted 226
3 SASI_Rn02_00384219 predicted 624
4 SASI_Rn02_00384220 predicted 310
5 SASI_Rn02_00384221 predicted 482
6 SASI_Rn02_00384222 predicted 615
7 SASI_Rn02_00384223 predicted 208
8 SASI_Rn02_00384224 predicted 281
9 SASI_Rn02_00384225 predicted 476
10 SASI_Rn02_00384226 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296454 predicted 256
2 SASI_Mm02_00296455 predicted 1527
3 SASI_Mm02_00296456 predicted 411
4 SASI_Mm02_00296457 predicted 372
5 SASI_Mm02_00296458 predicted 396
6 SASI_Mm02_00296459 predicted 680
7 SASI_Mm02_00296460 predicted 1502
8 SASI_Mm02_00296461 predicted 1445
9 SASI_Mm02_00296462 predicted 964
10 SASI_Mm02_00296463 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249456 predicted 263
2 SASI_Mm01_00249457 predicted 1539
3 SASI_Mm01_00249458 predicted 411
4 SASI_Mm01_00249459 predicted 369
5 SASI_Mm01_00249460 predicted 397
6 SASI_Mm01_00249461 predicted 1504
7 SASI_Mm01_00249462 predicted 1451
8 SASI_Mm01_00249463 predicted 972
9 SASI_Mm01_00249464 predicted 1526
10 SASI_Mm01_00249465 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223591 predicted 211
2 SASI_Mm01_00223592 predicted 363
3 SASI_Mm01_00223593 predicted 319
4 SASI_Mm01_00223594 predicted 346
5 SASI_Mm01_00223595 predicted 627
6 SASI_Mm01_00223596 predicted 1387
7 SASI_Mm01_00223597 predicted 922
8 SASI_Mm01_00223598 predicted 1021
9 SASI_Mm01_00223599 predicted 901
10 SASI_Mm01_00223600 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233086 predicted 210
2 SASI_Mm01_00233087 predicted 355
3 SASI_Mm01_00233088 predicted 316
4 SASI_Mm01_00233089 predicted 340
5 SASI_Mm01_00233090 predicted 626
6 SASI_Mm01_00233091 predicted 1388
7 SASI_Mm01_00233092 predicted 913
8 SASI_Mm01_00233093 predicted 1022
9 SASI_Mm01_00233094 predicted 907
10 SASI_Mm01_00233095 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223718 predicted 211
2 SASI_Mm01_00223719 predicted 360
3 SASI_Mm01_00223720 predicted 320
4 SASI_Mm01_00223721 predicted 337
5 SASI_Mm01_00223722 predicted 620
6 SASI_Mm01_00223723 predicted 1389
7 SASI_Mm01_00223724 predicted 914
8 SASI_Mm01_00223725 predicted 1029
9 SASI_Mm01_00223726 predicted 898
10 SASI_Mm01_00223727 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284221 predicted 264
2 SASI_Mm01_00284222 predicted 412
3 SASI_Mm01_00284223 predicted 376
4 SASI_Mm01_00284224 predicted 396
5 SASI_Mm01_00284225 predicted 684
6 SASI_Mm01_00284226 predicted 762
7 SASI_Mm01_00284227 predicted 977
8 SASI_Mm01_00284228 predicted 1075
9 SASI_Mm01_00284229 predicted 961
10 SASI_Mm01_00284230 predicted 1142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081230
MAP9 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-1509s21c1
Sequence:CCGGCAGACAAGGCTGATCACATAACTCGAGTTATGTGATCAGCCTTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-1088s21c1
Sequence:CCGGTGGGATTCCTTGCTATCAAATCTCGAGATTTGATAGCAAGGAATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-399s21c1
Sequence:CCGGACTTTGACAGTGACGAGATTGCTCGAGCAATCTCGTCACTGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-1436s21c1
Sequence:CCGGGCTACCTCCTCACACTATTTACTCGAGTAAATAGTGTGAGGAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081230.1-4379s21c1
Sequence:CCGGCTCAACCTGTGCGGGATTTATCTCGAGATAAATCCCGCACAGGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081230
MAP9 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-1509s21c1
Sequence:CCGGCAGACAAGGCTGATCACATAACTCGAGTTATGTGATCAGCCTTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-1088s21c1
Sequence:CCGGTGGGATTCCTTGCTATCAAATCTCGAGATTTGATAGCAAGGAATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-399s21c1
Sequence:CCGGACTTTGACAGTGACGAGATTGCTCGAGCAATCTCGTCACTGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-1436s21c1
Sequence:CCGGGCTACCTCCTCACACTATTTACTCGAGTAAATAGTGTGAGGAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081230.1-4379s21c1
Sequence:CCGGCTCAACCTGTGCGGGATTTATCTCGAGATAAATCCCGCACAGGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081230
MAP9 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-1509s21c1
Sequence:CCGGCAGACAAGGCTGATCACATAACTCGAGTTATGTGATCAGCCTTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-1088s21c1
Sequence:CCGGTGGGATTCCTTGCTATCAAATCTCGAGATTTGATAGCAAGGAATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-399s21c1
Sequence:CCGGACTTTGACAGTGACGAGATTGCTCGAGCAATCTCGTCACTGTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081230.1-1436s21c1
Sequence:CCGGGCTACCTCCTCACACTATTTACTCGAGTAAATAGTGTGAGGAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081230.1-4379s21c1
Sequence:CCGGCTCAACCTGTGCGGGATTTATCTCGAGATAAATCCCGCACAGGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024826
MAP9 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 9
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-829s1c1
Sequence:CCGGGAGGAGAAGGATGGACTAGAACTCGAGTTCTAGTCCATCCTTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024826.1-1190s1c1
Sequence:CCGGCTGATGACCTTGAAGAAGAAACTCGAGTTTCTTCTTCAAGGTCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-1247s1c1
Sequence:CCGGCAGTTGATCCACTACTATCTACTCGAGTAGATAGTAGTGGATCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024826.1-1492s1c1
Sequence:CCGGGAGAAGAAGCATTAGCATCATCTCGAGATGATGCTAATGCTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-373s1c1
Sequence:CCGGGCCAGACAAAGGAGTTCTGAACTCGAGTTCAGAACTCCTTTGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-968s1c1
Sequence:CCGGCTGAGGATTCATGCTTAACAACTCGAGTTGTTAAGCATGAATCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024826
MAP9 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 9
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-829s1c1
Sequence:CCGGGAGGAGAAGGATGGACTAGAACTCGAGTTCTAGTCCATCCTTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024826.1-1190s1c1
Sequence:CCGGCTGATGACCTTGAAGAAGAAACTCGAGTTTCTTCTTCAAGGTCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-1247s1c1
Sequence:CCGGCAGTTGATCCACTACTATCTACTCGAGTAGATAGTAGTGGATCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024826.1-1492s1c1
Sequence:CCGGGAGAAGAAGCATTAGCATCATCTCGAGATGATGCTAATGCTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-373s1c1
Sequence:CCGGGCCAGACAAAGGAGTTCTGAACTCGAGTTCAGAACTCCTTTGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-968s1c1
Sequence:CCGGCTGAGGATTCATGCTTAACAACTCGAGTTGTTAAGCATGAATCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024826
MAP9 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 9
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-829s1c1
Sequence:CCGGGAGGAGAAGGATGGACTAGAACTCGAGTTCTAGTCCATCCTTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024826.1-1190s1c1
Sequence:CCGGCTGATGACCTTGAAGAAGAAACTCGAGTTTCTTCTTCAAGGTCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-1247s1c1
Sequence:CCGGCAGTTGATCCACTACTATCTACTCGAGTAGATAGTAGTGGATCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024826.1-1492s1c1
Sequence:CCGGGAGAAGAAGCATTAGCATCATCTCGAGATGATGCTAATGCTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-373s1c1
Sequence:CCGGGCCAGACAAAGGAGTTCTGAACTCGAGTTCAGAACTCCTTTGTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024826.1-968s1c1
Sequence:CCGGCTGAGGATTCATGCTTAACAACTCGAGTTGTTAAGCATGAATCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)