EMAIL THIS PAGE TO A FRIEND

MAPK10

mitogen-activated protein kinase 10

171 Gene Product Result for
Synonyms: JNK3 JNK3A PRKM10 SAPK1b p493F12 p54bSAPK
UniProtKB ID: P53779, A6NFS3, A6NG28, B3KQ94, Q15707, Q49AP1
Gene ID:
Human(5602) Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This protein is a neuronal-specific form of c-Jun N-terminal kinases (JNKs). Through its phosphorylation and nuclear localization, this kinase plays regulatory roles in the signaling pathways during neuronal apoptosis. Beta-arrestin 2, a receptor-regulated MAP kinase scaffold protein, is found to interact with, and stimulate the phosphorylation of this kinase by MAP kinase kinase 4 (MKK4). Cyclin-dependent kianse 5 can phosphorylate, and inhibit the activity of this kinase, which may be important in preventing neuronal apoptosis. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(26414) mitogen-activated protein kinase 10
Rat(25272) mitogen activated protein kinase 10
naked mole-rat(101712980) mitogen-activated protein kinase 10
Domestic Rabbit(100337999) mitogen-activated protein kinase 10
domestic guinea pig(100718766) mitogen-activated protein kinase 10
sheep(101120665) mitogen-activated protein kinase 10
Zebrafish(569698) mitogen-activated protein kinase 10
cow(537631) mitogen-activated protein kinase 10
Horse(100052608) mitogen-activated protein kinase 10
domestic cat(101101463) mitogen-activated protein kinase 10
dog(478464) mitogen-activated protein kinase 10
chicken(422592) mitogen-activated protein kinase 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412174 ANTI-MAPK10 antibody produced in mouse clone 3A3-1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4502403 Anti-MAPK10 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB2107296 Anti-MAPK10 antibody produced in rabbit affinity isolated antibody horse, rabbit, guinea pig, dog, rat, mouse, bovine, goat, human
western blot pricing
HPA060304 Anti-MAPK10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4503929 Anti-phospho-JNK1/2/3 (pThr183+Tyr185) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300261 Anti-phospho-MAPK8/MAPK9/MAPK10 (pThr183/pTyr185) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, western blot pricing
SAB4504449 Anti-phospho-SAPK/JNK (pThr183) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504450 Anti-phospho-SAPK/JNK (pTyr185) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
WH0005602M5 Monoclonal Anti-MAPK10 antibody produced in mouse clone 3B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404251 Monoclonal Anti-MAPK10 antibody produced in mouse clone 4E12-1F7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB5300430 Monoclonal Anti-MAPK10 antibody produced in mouse clone 10E4A4, ascites fluid human, mouse
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138982 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002753 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140981 MISSION® esiRNA esiRNA human MAPK10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002753 Rosetta Predictions human pricing
NM_138980 Rosetta Predictions human pricing
NM_138981 Rosetta Predictions human pricing
NM_138982 Rosetta Predictions human pricing
NM_012806 Rosetta Predictions rat pricing
NM_001081567 Rosetta Predictions mouse pricing
NM_009158 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142305 predicted 1942
2 SASI_Hs01_00142306 predicted 1037
3 SASI_Hs01_00142307 predicted 946
4 SASI_Hs01_00142309 predicted 1093
5 SASI_Hs01_00142310 predicted 1212
6 SASI_Hs01_00142311 predicted 1234
7 SASI_Hs01_00142312 predicted 1037
8 SASI_Hs01_00142313 predicted 1030
9 SASI_Hs01_00142314 predicted 1035
10 SASI_Hs02_00334370 predicted 1240
11 SASI_Hs01_00142308 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133649 predicted 2272
2 SASI_Hs01_00133650 predicted 2331
3 SASI_Hs01_00133651 predicted 1364
4 SASI_Hs01_00133652 predicted 2364
5 SASI_Hs01_00133653 predicted 1286
6 SASI_Hs01_00133655 predicted 1543
7 SASI_Hs01_00133656 predicted 1570
8 SASI_Hs01_00133657 predicted 1368
9 SASI_Hs01_00133658 predicted 1358
10 SASI_Hs02_00364023 predicted 2390
11 SASI_Hs01_00133654 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192945 predicted 1723
2 SASI_Hs01_00192946 predicted 817
3 SASI_Hs01_00192947 predicted 731
4 SASI_Hs01_00192949 predicted 880
5 SASI_Hs01_00192950 predicted 996
6 SASI_Hs01_00192951 predicted 1018
7 SASI_Hs01_00192952 predicted 827
8 SASI_Hs01_00192953 predicted 808
9 SASI_Hs01_00192954 predicted 809
10 SASI_Hs02_00364024 predicted 1018
11 SASI_Hs01_00192948 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037359 predicted 1778
2 SASI_Hs01_00037360 predicted 1839
3 SASI_Hs01_00037361 predicted 875
4 SASI_Hs01_00037362 predicted 1881
5 SASI_Hs01_00037363 predicted 791
6 SASI_Hs01_00037365 predicted 1049
7 SASI_Hs01_00037366 predicted 1079
8 SASI_Hs01_00037367 predicted 889
9 SASI_Hs01_00037368 predicted 865
10 SASI_Hs02_00364025 predicted 1907
11 SASI_Hs01_00037364 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113455 predicted 469
2 SASI_Rn01_00113456 predicted 1414
3 SASI_Rn01_00113457 predicted 1249
4 SASI_Rn01_00113458 predicted 895
5 SASI_Rn01_00113459 predicted 1260
6 SASI_Rn01_00113460 predicted 828
7 SASI_Rn01_00113462 predicted 1000
8 SASI_Rn01_00113463 predicted 1068
9 SASI_Rn02_00260248 predicted 1094
10 SASI_Rn01_00113464 predicted 1006
11 SASI_Rn01_00113461 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298710 predicted 1372
2 SASI_Mm02_00298711 predicted 974
3 SASI_Mm02_00298712 predicted 1522
4 SASI_Mm02_00298713 predicted 1577
5 SASI_Mm02_00298714 predicted 594
6 SASI_Mm02_00298715 predicted 1206
7 SASI_Mm02_00298716 predicted 1139
8 SASI_Mm02_00298717 predicted 644
9 SASI_Mm02_00298718 predicted 786
10 SASI_Mm02_00298719 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315483 predicted 1377
2 SASI_Mm01_00107189 predicted 976
3 SASI_Mm01_00107192 predicted 1519
4 SASI_Mm02_00315484 predicted 1578
5 SASI_Mm02_00315485 predicted 589
6 SASI_Mm02_00315486 predicted 1204
7 SASI_Mm02_00315487 predicted 1131
8 SASI_Mm01_00107197 predicted 644
9 SASI_Mm02_00315488 predicted 787
10 SASI_Mm02_00315489 predicted 1113
11 SASI_Mm01_00107188 predicted 320
12 SASI_Mm01_00107190 predicted 1335
13 SASI_Mm01_00107191 predicted 1184
14 SASI_Mm01_00107193 predicted 1107
15 SASI_Mm01_00107194 predicted 957
16 SASI_Mm01_00107195 predicted 1482
17 SASI_Mm01_00107196 predicted 1380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138982
VALIDATED
MAPK10 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 10
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1237s21c1
Sequence:CCGGGAATTATTCACAGGGATTTAACTCGAGTTAAATCCCTGTGAATAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1029s21c1
Sequence:CCGGATGAAGTGTGTGAACCATAAACTCGAGTTTATGGTTCACACACTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1680s21c1
Sequence:CCGGGCCAGGGACTTGTTGTCAAAGCTCGAGCTTTGACAACAAGTCCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138982.2-2499s21c1
Sequence:CCGGGCCTAGTCAGATGGATGTAGACTCGAGTCTACATCCATCTGACTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138982.1-1925s1c1
Sequence:CCGGCATACAGCACTACTTACTTAGCTCGAGCTAAGTAAGTAGTGCTGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.1-580s1c1
Sequence:CCGGCCAAATGTTGTGTGGCATTAACTCGAGTTAATGCCACACAACATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138982.1-2009s1c1
Sequence:CCGGCCATTTCATGTGATCTATTACCTCGAGGTAATAGATCACATGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.1-146s1c1
Sequence:CCGGCAAGTGGATGTGTCATATATTCTCGAGAATATATGACACATCCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.1-326s1c1
Sequence:CCGGGACAGAAATGTGGCCATTAAGCTCGAGCTTAATGGCCACATTTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1493s21c1
Sequence:CCGGTGACCAGTGGAATAAGGTAATCTCGAGATTACCTTATTCCACTGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.x-1125s1c1
Sequence:CCGGCCTTACAGCATCCCTACATCACTCGAGTGATGTAGGGATGCTGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.x-947s1c1
Sequence:CCGGGTAAGAAACTATGTGGAGAATCTCGAGATTCTCCACATAGTTTCTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.x-338s1c1
Sequence:CCGGGCCATTAAGAAGCTCAGCAGACTCGAGTCTGCTGAGCTTCTTAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138982.x-1700s1c1
Sequence:CCGGCCAATGATGCTTACTACAGAACTCGAGTTCTGTAGTAAGCATCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138982.2-2259s21c1
Sequence:CCGGGTATTGCAGCTAAGCTCAAATCTCGAGATTTGAGCTTAGCTGCAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1275s21c1
Sequence:CCGGGTCAAGTCTGATTGCACATTGCTCGAGCAATGTGCAATCAGACTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_138982.x-1039s1c1
Sequence:CCGGCAATAAACTCAAAGCCAGCCACTCGAGTGGCTGGCTTTGAGTTTATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_138982.1-545s1c1
Sequence:CCGGGAATTAGACCATGAGCGAATGCTCGAGCATTCGCTCATGGTCTAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138982
VALIDATED
MAPK10 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 10
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1237s21c1
Sequence:CCGGGAATTATTCACAGGGATTTAACTCGAGTTAAATCCCTGTGAATAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1029s21c1
Sequence:CCGGATGAAGTGTGTGAACCATAAACTCGAGTTTATGGTTCACACACTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1680s21c1
Sequence:CCGGGCCAGGGACTTGTTGTCAAAGCTCGAGCTTTGACAACAAGTCCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138982.2-2499s21c1
Sequence:CCGGGCCTAGTCAGATGGATGTAGACTCGAGTCTACATCCATCTGACTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138982.1-1925s1c1
Sequence:CCGGCATACAGCACTACTTACTTAGCTCGAGCTAAGTAAGTAGTGCTGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.1-580s1c1
Sequence:CCGGCCAAATGTTGTGTGGCATTAACTCGAGTTAATGCCACACAACATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138982.1-2009s1c1
Sequence:CCGGCCATTTCATGTGATCTATTACCTCGAGGTAATAGATCACATGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.1-146s1c1
Sequence:CCGGCAAGTGGATGTGTCATATATTCTCGAGAATATATGACACATCCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.1-326s1c1
Sequence:CCGGGACAGAAATGTGGCCATTAAGCTCGAGCTTAATGGCCACATTTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1493s21c1
Sequence:CCGGTGACCAGTGGAATAAGGTAATCTCGAGATTACCTTATTCCACTGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.x-1125s1c1
Sequence:CCGGCCTTACAGCATCCCTACATCACTCGAGTGATGTAGGGATGCTGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.x-947s1c1
Sequence:CCGGGTAAGAAACTATGTGGAGAATCTCGAGATTCTCCACATAGTTTCTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.x-338s1c1
Sequence:CCGGGCCATTAAGAAGCTCAGCAGACTCGAGTCTGCTGAGCTTCTTAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138982.x-1700s1c1
Sequence:CCGGCCAATGATGCTTACTACAGAACTCGAGTTCTGTAGTAAGCATCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138982.2-2259s21c1
Sequence:CCGGGTATTGCAGCTAAGCTCAAATCTCGAGATTTGAGCTTAGCTGCAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1275s21c1
Sequence:CCGGGTCAAGTCTGATTGCACATTGCTCGAGCAATGTGCAATCAGACTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_138982.x-1039s1c1
Sequence:CCGGCAATAAACTCAAAGCCAGCCACTCGAGTGGCTGGCTTTGAGTTTATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_138982.1-545s1c1
Sequence:CCGGGAATTAGACCATGAGCGAATGCTCGAGCATTCGCTCATGGTCTAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138982
VALIDATED
MAPK10 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 10
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1237s21c1
Sequence:CCGGGAATTATTCACAGGGATTTAACTCGAGTTAAATCCCTGTGAATAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1029s21c1
Sequence:CCGGATGAAGTGTGTGAACCATAAACTCGAGTTTATGGTTCACACACTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1680s21c1
Sequence:CCGGGCCAGGGACTTGTTGTCAAAGCTCGAGCTTTGACAACAAGTCCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138982.2-2499s21c1
Sequence:CCGGGCCTAGTCAGATGGATGTAGACTCGAGTCTACATCCATCTGACTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138982.1-1925s1c1
Sequence:CCGGCATACAGCACTACTTACTTAGCTCGAGCTAAGTAAGTAGTGCTGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.1-580s1c1
Sequence:CCGGCCAAATGTTGTGTGGCATTAACTCGAGTTAATGCCACACAACATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138982.1-2009s1c1
Sequence:CCGGCCATTTCATGTGATCTATTACCTCGAGGTAATAGATCACATGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.1-146s1c1
Sequence:CCGGCAAGTGGATGTGTCATATATTCTCGAGAATATATGACACATCCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.1-326s1c1
Sequence:CCGGGACAGAAATGTGGCCATTAAGCTCGAGCTTAATGGCCACATTTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1493s21c1
Sequence:CCGGTGACCAGTGGAATAAGGTAATCTCGAGATTACCTTATTCCACTGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.x-1125s1c1
Sequence:CCGGCCTTACAGCATCCCTACATCACTCGAGTGATGTAGGGATGCTGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.x-947s1c1
Sequence:CCGGGTAAGAAACTATGTGGAGAATCTCGAGATTCTCCACATAGTTTCTTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138982.x-338s1c1
Sequence:CCGGGCCATTAAGAAGCTCAGCAGACTCGAGTCTGCTGAGCTTCTTAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138982.x-1700s1c1
Sequence:CCGGCCAATGATGCTTACTACAGAACTCGAGTTCTGTAGTAAGCATCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138982.2-2259s21c1
Sequence:CCGGGTATTGCAGCTAAGCTCAAATCTCGAGATTTGAGCTTAGCTGCAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138982.2-1275s21c1
Sequence:CCGGGTCAAGTCTGATTGCACATTGCTCGAGCAATGTGCAATCAGACTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_138982.x-1039s1c1
Sequence:CCGGCAATAAACTCAAAGCCAGCCACTCGAGTGGCTGGCTTTGAGTTTATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_138982.1-545s1c1
Sequence:CCGGGAATTAGACCATGAGCGAATGCTCGAGCATTCGCTCATGGTCTAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009158
MAPK10 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.2-731s1c1
Sequence:CCGGCTCAACCTTCACCGTTCTTAACTCGAGTTAAGAACGGTGAAGGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009158.2-2167s21c1
Sequence:CCGGCAATAGAGAGATCCAACATAACTCGAGTTATGTTGGATCTCTCTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009158.2-1232s21c1
Sequence:CCGGGTATGTGGTGACGCGATATTACTCGAGTAATATCGCGTCACCACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009158.2-1524s21c1
Sequence:CCGGGCGGATTCTGAGCACAATAAACTCGAGTTTATTGTGCTCAGAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-1470s1c1
Sequence:CCGGCGAAGAATGGAAAGAACTTATCTCGAGATAAGTTCTTTCCATTCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009158.1-1753s1c1
Sequence:CCGGGCGATAGAACACAGCACACATCTCGAGATGTGTGCTGTGTTCTATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-726s1c1
Sequence:CCGGCCAAGATGTCTACTTAGTGATCTCGAGATCACTAAGTAGACATCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-900s1c1
Sequence:CCGGCAAGTCTGATTGCACACTGAACTCGAGTTCAGTGTGCAATCAGACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-397s1c1
Sequence:CCGGGTGTCATCTATTGCCAAACATCTCGAGATGTTTGGCAATAGATGACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009158
MAPK10 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.2-731s1c1
Sequence:CCGGCTCAACCTTCACCGTTCTTAACTCGAGTTAAGAACGGTGAAGGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009158.2-2167s21c1
Sequence:CCGGCAATAGAGAGATCCAACATAACTCGAGTTATGTTGGATCTCTCTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009158.2-1232s21c1
Sequence:CCGGGTATGTGGTGACGCGATATTACTCGAGTAATATCGCGTCACCACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009158.2-1524s21c1
Sequence:CCGGGCGGATTCTGAGCACAATAAACTCGAGTTTATTGTGCTCAGAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-1470s1c1
Sequence:CCGGCGAAGAATGGAAAGAACTTATCTCGAGATAAGTTCTTTCCATTCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009158.1-1753s1c1
Sequence:CCGGGCGATAGAACACAGCACACATCTCGAGATGTGTGCTGTGTTCTATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-726s1c1
Sequence:CCGGCCAAGATGTCTACTTAGTGATCTCGAGATCACTAAGTAGACATCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-900s1c1
Sequence:CCGGCAAGTCTGATTGCACACTGAACTCGAGTTCAGTGTGCAATCAGACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-397s1c1
Sequence:CCGGGTGTCATCTATTGCCAAACATCTCGAGATGTTTGGCAATAGATGACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009158
MAPK10 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.2-731s1c1
Sequence:CCGGCTCAACCTTCACCGTTCTTAACTCGAGTTAAGAACGGTGAAGGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009158.2-2167s21c1
Sequence:CCGGCAATAGAGAGATCCAACATAACTCGAGTTATGTTGGATCTCTCTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009158.2-1232s21c1
Sequence:CCGGGTATGTGGTGACGCGATATTACTCGAGTAATATCGCGTCACCACATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009158.2-1524s21c1
Sequence:CCGGGCGGATTCTGAGCACAATAAACTCGAGTTTATTGTGCTCAGAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-1470s1c1
Sequence:CCGGCGAAGAATGGAAAGAACTTATCTCGAGATAAGTTCTTTCCATTCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009158.1-1753s1c1
Sequence:CCGGGCGATAGAACACAGCACACATCTCGAGATGTGTGCTGTGTTCTATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-726s1c1
Sequence:CCGGCCAAGATGTCTACTTAGTGATCTCGAGATCACTAAGTAGACATCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-900s1c1
Sequence:CCGGCAAGTCTGATTGCACACTGAACTCGAGTTCAGTGTGCAATCAGACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009158.1-397s1c1
Sequence:CCGGGTGTCATCTATTGCCAAACATCTCGAGATGTTTGGCAATAGATGACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002753
VALIDATED
MAPK10 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002753.x-461s1c1
Sequence:CCGGGCCGCGTATGATGCTGTCCTTCTCGAGAAGGACAGCATCATACGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002753.x-1276s1c1
Sequence:CCGGCGACGCCTTACAGCATCCCTACTCGAGTAGGGATGCTGTAAGGCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002753.x-494s1c1
Sequence:CCGGGCCATTAAGAAGCTCAGCAGACTCGAGTCTGCTGAGCTTCTTAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002753.x-1103s1c1
Sequence:CCGGGTAAGAAACTATGTGGAGAATCTCGAGATTCTCCACATAGTTTCTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002753.x-1861s1c1
Sequence:CCGGCCAATGATGCTTACTACAGAACTCGAGTTCTGTAGTAAGCATCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002753
VALIDATED
MAPK10 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002753.x-461s1c1
Sequence:CCGGGCCGCGTATGATGCTGTCCTTCTCGAGAAGGACAGCATCATACGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002753.x-1276s1c1
Sequence:CCGGCGACGCCTTACAGCATCCCTACTCGAGTAGGGATGCTGTAAGGCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002753.x-494s1c1
Sequence:CCGGGCCATTAAGAAGCTCAGCAGACTCGAGTCTGCTGAGCTTCTTAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002753.x-1103s1c1
Sequence:CCGGGTAAGAAACTATGTGGAGAATCTCGAGATTCTCCACATAGTTTCTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002753.x-1861s1c1
Sequence:CCGGCCAATGATGCTTACTACAGAACTCGAGTTCTGTAGTAAGCATCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002753
VALIDATED
MAPK10 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002753.x-461s1c1
Sequence:CCGGGCCGCGTATGATGCTGTCCTTCTCGAGAAGGACAGCATCATACGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_002753.x-1276s1c1
Sequence:CCGGCGACGCCTTACAGCATCCCTACTCGAGTAGGGATGCTGTAAGGCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002753.x-494s1c1
Sequence:CCGGGCCATTAAGAAGCTCAGCAGACTCGAGTCTGCTGAGCTTCTTAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002753.x-1103s1c1
Sequence:CCGGGTAAGAAACTATGTGGAGAATCTCGAGATTCTCCACATAGTTTCTTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002753.x-1861s1c1
Sequence:CCGGCCAATGATGCTTACTACAGAACTCGAGTTCTGTAGTAAGCATCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)