EMAIL THIS PAGE TO A FRIEND

MAPK12

mitogen-activated protein kinase 12

81 Gene Product Result for
Synonyms: ERK3 ERK6 P38GAMMA PRKM12 SAPK-3 SAPK3
UniProtKB ID: P53778, Q14260, Q99588, Q99672
Gene ID:
Human(6300) Summary: Activation of members of the mitogen-activated protein kinase family is a major mechanism for transduction of extracellular signals. Stress-activated protein kinases are one subclass of MAP kinases. The protein encoded by this gene functions as a signal transducer during differentiation of myoblasts to myotubes. [provided by RefSeq, Jul 2008]
Mouse(29857) mitogen-activated protein kinase 12
Rat(60352) mitogen-activated protein kinase 12
naked mole-rat(101706002) mitogen-activated protein kinase 12
domestic guinea pig(100721194) mitogen-activated protein kinase 12
sheep(101115956) mitogen-activated protein kinase 12
chicken(769763) mitogen-activated protein kinase 12
cow(512943) mitogen-activated protein kinase 12
domestic cat(101081149) mitogen-activated protein kinase 12
dog(607023) mitogen-activated protein kinase 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA054562 Anti-MAPK12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2107192 Anti-MAPK12 antibody produced in rabbit affinity isolated antibody rabbit, mouse, guinea pig, human, horse
ELISA, western blot pricing
SAB1411224 Anti-MAPK12 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
SAB2104738 Anti-MAPK12, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, horse, goat, human, guinea pig, mouse, sheep, rabbit
western blot pricing
SAB1304625 ANTI-MOUSE MAPK12 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
WH0006300M1 Monoclonal Anti-MAPK12 antibody produced in mouse clone 4F4-3D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409626 Monoclonal Anti-MAPK12 antibody produced in mouse clone 1A4, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB1409627 Monoclonal Anti-MAPK12 antibody produced in mouse clone 2C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409628 Monoclonal Anti-MAPK12 antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409629 Monoclonal Anti-MAPK12 antibody produced in mouse clone 1G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404353 Monoclonal Anti-MAPK12, (C-terminal) antibody produced in mouse clone 1G4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002969 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002969 Rosetta Predictions human pricing
NM_021746 Rosetta Predictions rat pricing
NM_013871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032309 predicted 533
2 SASI_Hs01_00032310 predicted 732
3 SASI_Hs01_00032311 predicted 794
4 SASI_Hs01_00032312 predicted 1236
5 SASI_Hs01_00032313 predicted 1502
6 SASI_Hs01_00032314 predicted 779
7 SASI_Hs01_00032315 predicted 1345
8 SASI_Hs01_00032316 predicted 1115
9 SASI_Hs01_00032317 predicted 298
10 SASI_Hs01_00032318 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262783 predicted 470
2 SASI_Rn02_00262784 predicted 1185
3 SASI_Rn02_00262785 predicted 319
4 SASI_Rn02_00262786 predicted 563
5 SASI_Rn02_00262787 predicted 753
6 SASI_Rn02_00262788 predicted 669
7 SASI_Rn02_00262789 predicted 823
8 SASI_Rn02_00262790 predicted 709
9 SASI_Rn02_00262791 predicted 715
10 SASI_Rn02_00262792 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105363 predicted 482
2 SASI_Mm01_00105364 predicted 1059
3 SASI_Mm01_00105365 predicted 289
4 SASI_Mm01_00105367 predicted 534
5 SASI_Mm01_00105368 predicted 1504
6 SASI_Mm01_00105369 predicted 765
7 SASI_Mm01_00105370 predicted 1465
8 SASI_Mm02_00322887 predicted 490
9 SASI_Mm01_00105371 predicted 428
10 SASI_Mm01_00105372 predicted 1191
11 SASI_Mm01_00105366 predicted 1527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002969
VALIDATED
MAPK12 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 12
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-730s21c1
Sequence:GTACCGGTCCCGAGGTCATCTTGAATTGCTCGAGCAATTCAAGATGACCTCGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-1114s21c1
Sequence:CCGGCCAGGTCCAGAAGTATGATGACTCGAGTCATCATACTTCTGGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002969.3-1346s21c1
Sequence:CCGGTTGCATCCCAAGGCATCCATCCTCGAGGATGGATGCCTTGGGATGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-419s21c1
Sequence:CCGGCTGGACGTATTCACTCCTGATCTCGAGATCAGGAGTGAATACGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-1162s21c1
Sequence:CCGGGGATGAATGGAAGCGTGTTACCTCGAGGTAACACGCTTCCATTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-446s21c1
Sequence:CCGGCTGGATGACTTCACGGACTTTCTCGAGAAAGTCCGTGAAGTCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002969.3-1521s21c1
Sequence:GTACCGGGTGCTCTCAGAAACCTCAGAGCTCGAGCTCTGAGGTTTCTGAGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002969.3-536s1c1
Sequence:CCGGCGGATCCAGTTCCTCGTGTACCTCGAGGTACACGAGGAACTGGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002969.3-1446s1c1
Sequence:CCGGCTGAACTTTCTGGACAAGACCCTCGAGGGTCTTGTCCAGAAAGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002969.2-604s1c1
Sequence:CCGGCTGGATGACTTCACGGACTTTCTCGAGAAAGTCCGTGAAGTCATCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002969.2-1272s1c1
Sequence:CCGGCCAGGTCCAGAAGTATGATGACTCGAGTCATCATACTTCTGGACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002969.2-489s1c1
Sequence:CCGGGCCCTTCCAGTCCGAGCTGTTCTCGAGAACAGCTCGGACTGGAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002969.2-577s1c1
Sequence:CCGGCTGGACGTATTCACTCCTGATCTCGAGATCAGGAGTGAATACGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002969.2-897s1c1
Sequence:CCGGCATCTTGAATTGGATGCGCTACTCGAGTAGCGCATCCAATTCAAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002969
VALIDATED
MAPK12 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 12
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-730s21c1
Sequence:GTACCGGTCCCGAGGTCATCTTGAATTGCTCGAGCAATTCAAGATGACCTCGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-1114s21c1
Sequence:CCGGCCAGGTCCAGAAGTATGATGACTCGAGTCATCATACTTCTGGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002969.3-1346s21c1
Sequence:CCGGTTGCATCCCAAGGCATCCATCCTCGAGGATGGATGCCTTGGGATGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-419s21c1
Sequence:CCGGCTGGACGTATTCACTCCTGATCTCGAGATCAGGAGTGAATACGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-1162s21c1
Sequence:CCGGGGATGAATGGAAGCGTGTTACCTCGAGGTAACACGCTTCCATTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-446s21c1
Sequence:CCGGCTGGATGACTTCACGGACTTTCTCGAGAAAGTCCGTGAAGTCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002969.3-1521s21c1
Sequence:GTACCGGGTGCTCTCAGAAACCTCAGAGCTCGAGCTCTGAGGTTTCTGAGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002969.3-536s1c1
Sequence:CCGGCGGATCCAGTTCCTCGTGTACCTCGAGGTACACGAGGAACTGGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002969.3-1446s1c1
Sequence:CCGGCTGAACTTTCTGGACAAGACCCTCGAGGGTCTTGTCCAGAAAGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002969.2-604s1c1
Sequence:CCGGCTGGATGACTTCACGGACTTTCTCGAGAAAGTCCGTGAAGTCATCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002969.2-1272s1c1
Sequence:CCGGCCAGGTCCAGAAGTATGATGACTCGAGTCATCATACTTCTGGACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002969.2-489s1c1
Sequence:CCGGGCCCTTCCAGTCCGAGCTGTTCTCGAGAACAGCTCGGACTGGAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002969.2-577s1c1
Sequence:CCGGCTGGACGTATTCACTCCTGATCTCGAGATCAGGAGTGAATACGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002969.2-897s1c1
Sequence:CCGGCATCTTGAATTGGATGCGCTACTCGAGTAGCGCATCCAATTCAAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002969
VALIDATED
MAPK12 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 12
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-730s21c1
Sequence:GTACCGGTCCCGAGGTCATCTTGAATTGCTCGAGCAATTCAAGATGACCTCGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-1114s21c1
Sequence:CCGGCCAGGTCCAGAAGTATGATGACTCGAGTCATCATACTTCTGGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002969.3-1346s21c1
Sequence:CCGGTTGCATCCCAAGGCATCCATCCTCGAGGATGGATGCCTTGGGATGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-419s21c1
Sequence:CCGGCTGGACGTATTCACTCCTGATCTCGAGATCAGGAGTGAATACGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-1162s21c1
Sequence:CCGGGGATGAATGGAAGCGTGTTACCTCGAGGTAACACGCTTCCATTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002969.3-446s21c1
Sequence:CCGGCTGGATGACTTCACGGACTTTCTCGAGAAAGTCCGTGAAGTCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002969.3-1521s21c1
Sequence:GTACCGGGTGCTCTCAGAAACCTCAGAGCTCGAGCTCTGAGGTTTCTGAGAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002969.3-536s1c1
Sequence:CCGGCGGATCCAGTTCCTCGTGTACCTCGAGGTACACGAGGAACTGGATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002969.3-1446s1c1
Sequence:CCGGCTGAACTTTCTGGACAAGACCCTCGAGGGTCTTGTCCAGAAAGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002969.2-604s1c1
Sequence:CCGGCTGGATGACTTCACGGACTTTCTCGAGAAAGTCCGTGAAGTCATCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002969.2-1272s1c1
Sequence:CCGGCCAGGTCCAGAAGTATGATGACTCGAGTCATCATACTTCTGGACCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002969.2-489s1c1
Sequence:CCGGGCCCTTCCAGTCCGAGCTGTTCTCGAGAACAGCTCGGACTGGAAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002969.2-577s1c1
Sequence:CCGGCTGGACGTATTCACTCCTGATCTCGAGATCAGGAGTGAATACGTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002969.2-897s1c1
Sequence:CCGGCATCTTGAATTGGATGCGCTACTCGAGTAGCGCATCCAATTCAAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013871
MAPK12 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 12
Mouse
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-1211s21c1
Sequence:CCGGACGACTCCTTTGATGATGTAGCTCGAGCTACATCATCAAAGGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013871.3-1479s21c1
Sequence:CCGGTGCTGTGTAGACCCTTGAATCCTCGAGGATTCAAGGGTCTACACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-785s21c1
Sequence:CCGGATGTGGTAACCCGGTGGTATCCTCGAGGATACCACCGGGTTACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-535s21c1
Sequence:GTACCGGGAATCCAGTTTCTTGTGTATCCTCGAGGATACACAAGAAACTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013871.2-1533s21c1
Sequence:CCGGTTCTGGAGTTGTACATGAAATCTCGAGATTTCATGTACAACTCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-1107s21c1
Sequence:CCGGGAACCCAAGGCCCAGAAATATCTCGAGATATTTCTGGGCCTTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-1063s21c1
Sequence:CCGGCGTTAACCCATCCATACTTTGCTCGAGCAAAGTATGGATGGGTTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-757s21c1
Sequence:CCGGACACGCAGACAGTGGACATTTCTCGAGAAATGTCCACTGTCTGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-573s21c1
Sequence:CCGGTGATCTGGGCAAACTCATGAACTCGAGTTCATGAGTTTGCCCAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-518s21c1
Sequence:CCGGATGAGTCTCTGGACGACTTCACTCGAGTGAAGTCGTCCAGAGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013871.3-1516s21c1
Sequence:CCGGCAAACCTGTTCTTCGGCTTTCCTCGAGGAAAGCCGAAGAACAGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-810s21c1
Sequence:CCGGACCAGAGGTCATCTTGAATTGCTCGAGCAATTCAAGATGACCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-893s21c1
Sequence:CCGGCTGGGAAGATCCTGTTCAAAGCTCGAGCTTTGAACAGGATCTTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-539s1c1
Sequence:CCGGCCAGTTTCTTGTGTATCAGATCTCGAGATCTGATACACAAGAAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-455s1c1
Sequence:CCGGCACAGACTTCTACCTGGTGATCTCGAGATCACCAGGTAGAAGTCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-1173s1c1
Sequence:CCGGCGTGTGACTTACAAGGAAGTTCTCGAGAACTTCCTTGTAAGTCACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-726s1c1
Sequence:CCGGGCACCAGAGGTCATCTTGAATCTCGAGATTCAAGATGACCTCTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-799s1c1
Sequence:CCGGCGGAGATGATTACTGGGAAGACTCGAGTCTTCCCAGTAATCATCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013871
MAPK12 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 12
Mouse
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-1211s21c1
Sequence:CCGGACGACTCCTTTGATGATGTAGCTCGAGCTACATCATCAAAGGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013871.3-1479s21c1
Sequence:CCGGTGCTGTGTAGACCCTTGAATCCTCGAGGATTCAAGGGTCTACACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-785s21c1
Sequence:CCGGATGTGGTAACCCGGTGGTATCCTCGAGGATACCACCGGGTTACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-535s21c1
Sequence:GTACCGGGAATCCAGTTTCTTGTGTATCCTCGAGGATACACAAGAAACTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013871.2-1533s21c1
Sequence:CCGGTTCTGGAGTTGTACATGAAATCTCGAGATTTCATGTACAACTCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-1107s21c1
Sequence:CCGGGAACCCAAGGCCCAGAAATATCTCGAGATATTTCTGGGCCTTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-1063s21c1
Sequence:CCGGCGTTAACCCATCCATACTTTGCTCGAGCAAAGTATGGATGGGTTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-757s21c1
Sequence:CCGGACACGCAGACAGTGGACATTTCTCGAGAAATGTCCACTGTCTGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-573s21c1
Sequence:CCGGTGATCTGGGCAAACTCATGAACTCGAGTTCATGAGTTTGCCCAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-518s21c1
Sequence:CCGGATGAGTCTCTGGACGACTTCACTCGAGTGAAGTCGTCCAGAGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013871.3-1516s21c1
Sequence:CCGGCAAACCTGTTCTTCGGCTTTCCTCGAGGAAAGCCGAAGAACAGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-810s21c1
Sequence:CCGGACCAGAGGTCATCTTGAATTGCTCGAGCAATTCAAGATGACCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-893s21c1
Sequence:CCGGCTGGGAAGATCCTGTTCAAAGCTCGAGCTTTGAACAGGATCTTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-539s1c1
Sequence:CCGGCCAGTTTCTTGTGTATCAGATCTCGAGATCTGATACACAAGAAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-455s1c1
Sequence:CCGGCACAGACTTCTACCTGGTGATCTCGAGATCACCAGGTAGAAGTCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-1173s1c1
Sequence:CCGGCGTGTGACTTACAAGGAAGTTCTCGAGAACTTCCTTGTAAGTCACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-726s1c1
Sequence:CCGGGCACCAGAGGTCATCTTGAATCTCGAGATTCAAGATGACCTCTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-799s1c1
Sequence:CCGGCGGAGATGATTACTGGGAAGACTCGAGTCTTCCCAGTAATCATCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013871
MAPK12 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 12
Mouse
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-1211s21c1
Sequence:CCGGACGACTCCTTTGATGATGTAGCTCGAGCTACATCATCAAAGGAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013871.3-1479s21c1
Sequence:CCGGTGCTGTGTAGACCCTTGAATCCTCGAGGATTCAAGGGTCTACACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-785s21c1
Sequence:CCGGATGTGGTAACCCGGTGGTATCCTCGAGGATACCACCGGGTTACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-535s21c1
Sequence:GTACCGGGAATCCAGTTTCTTGTGTATCCTCGAGGATACACAAGAAACTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013871.2-1533s21c1
Sequence:CCGGTTCTGGAGTTGTACATGAAATCTCGAGATTTCATGTACAACTCCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-1107s21c1
Sequence:CCGGGAACCCAAGGCCCAGAAATATCTCGAGATATTTCTGGGCCTTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-1063s21c1
Sequence:CCGGCGTTAACCCATCCATACTTTGCTCGAGCAAAGTATGGATGGGTTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.2-757s21c1
Sequence:CCGGACACGCAGACAGTGGACATTTCTCGAGAAATGTCCACTGTCTGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-573s21c1
Sequence:CCGGTGATCTGGGCAAACTCATGAACTCGAGTTCATGAGTTTGCCCAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-518s21c1
Sequence:CCGGATGAGTCTCTGGACGACTTCACTCGAGTGAAGTCGTCCAGAGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013871.3-1516s21c1
Sequence:CCGGCAAACCTGTTCTTCGGCTTTCCTCGAGGAAAGCCGAAGAACAGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-810s21c1
Sequence:CCGGACCAGAGGTCATCTTGAATTGCTCGAGCAATTCAAGATGACCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013871.3-893s21c1
Sequence:CCGGCTGGGAAGATCCTGTTCAAAGCTCGAGCTTTGAACAGGATCTTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-539s1c1
Sequence:CCGGCCAGTTTCTTGTGTATCAGATCTCGAGATCTGATACACAAGAAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-455s1c1
Sequence:CCGGCACAGACTTCTACCTGGTGATCTCGAGATCACCAGGTAGAAGTCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-1173s1c1
Sequence:CCGGCGTGTGACTTACAAGGAAGTTCTCGAGAACTTCCTTGTAAGTCACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-726s1c1
Sequence:CCGGGCACCAGAGGTCATCTTGAATCTCGAGATTCAAGATGACCTCTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013871.2-799s1c1
Sequence:CCGGCGGAGATGATTACTGGGAAGACTCGAGTCTTCCCAGTAATCATCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)