EMAIL THIS PAGE TO A FRIEND

MAPK13

mitogen-activated protein kinase 13

76 Gene Product Result for
Synonyms: MAPK 13 MAPK-13 PRKM13 SAPK4 p38delta
UniProtKB ID: O15264, O14739, O15124, Q6FI46, Q9UNU0
Gene ID:
Human(5603) Summary: This gene encodes a member of the mitogen-activated protein (MAP) kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(26415) mitogen-activated protein kinase 13
Rat(29513) mitogen activated protein kinase 13
Zebrafish(100002318) mitogen-activated protein kinase 13
cow(535327) mitogen-activated protein kinase 13
dog(612821) mitogen-activated protein kinase 13
chicken(771145) mitogen-activated protein kinase 13
Goat(100860996) mitogen-activated protein kinase 13
sheep(100194428) mitogen-activated protein kinase 13
domestic guinea pig(100729280) mitogen-activated protein kinase 13
Domestic Rabbit(100344161) mitogen-activated protein kinase 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M1447 Anti-MAPK13 (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
M1572 Anti-MAPK13 (333-345) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA007667 Anti-MAPK13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat
immunohistochemistry, western blot pricing
SAB2104778 Anti-MAPK13 antibody produced in rabbit affinity isolated antibody rat, mouse, guinea pig, human
western blot pricing
SAB1411094 Anti-MAPK13 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
SAB1302486 ANTI-MOUSE MAPK13 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
WH0005603M2 Monoclonal Anti-MAPK13 antibody produced in mouse clone 2D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4100513 Monoclonal Anti-MAPK13 antibody produced in mouse clone MAPK13-A584, culture supernatant human
western blot pricing
SAB1409519 Monoclonal Anti-MAPK13 antibody produced in mouse clone 3G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409520 Monoclonal Anti-MAPK13 antibody produced in mouse clone 2C10-1C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409521 Monoclonal Anti-MAPK13 antibody produced in mouse clone 1E6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409522 Monoclonal Anti-MAPK13 antibody produced in mouse clone 3D8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409523 Monoclonal Anti-MAPK13 antibody produced in mouse clone 3D8, ascites fluid, solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1409524 Monoclonal Anti-MAPK13 antibody produced in mouse clone 2B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1409525 Monoclonal Anti-MAPK13 antibody produced in mouse clone 3H7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1409526 Monoclonal Anti-MAPK13 antibody produced in mouse clone 2B2, ascites fluid, solution human
ELISA, western blot pricing
SAB1404252 Monoclonal Anti-MAPK13, (C-terminal) antibody produced in mouse clone 1E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002754 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002754 Rosetta Predictions human pricing
NM_019231 Rosetta Predictions rat pricing
NM_011950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180787 predicted 473
2 SASI_Hs01_00180788 predicted 738
3 SASI_Hs01_00180789 predicted 269
4 SASI_Hs01_00180790 predicted 1176
5 SASI_Hs01_00180791 predicted 845
6 SASI_Hs01_00180792 predicted 1065
7 SASI_Hs01_00180793 predicted 608
8 SASI_Hs01_00180794 predicted 1237
9 SASI_Hs02_00334371 predicted 1191
10 SASI_Hs01_00180795 predicted 1282
11 SASI_Hs01_00180796 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262088 predicted 274
2 SASI_Rn02_00262089 predicted 239
3 SASI_Rn02_00262090 predicted 518
4 SASI_Rn02_00262091 predicted 433
5 SASI_Rn02_00262092 predicted 720
6 SASI_Rn02_00262093 predicted 523
7 SASI_Rn02_00262094 predicted 1115
8 SASI_Rn02_00262095 predicted 1078
9 SASI_Rn02_00262096 predicted 467
10 SASI_Rn02_00262097 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080915 predicted 802
2 SASI_Mm01_00080916 predicted 889
3 SASI_Mm01_00080917 predicted 683
4 SASI_Mm01_00080918 predicted 397
5 SASI_Mm01_00080919 predicted 659
6 SASI_Mm01_00080920 predicted 475
7 SASI_Mm01_00080921 predicted 854
8 SASI_Mm01_00080922 predicted 337
9 SASI_Mm01_00080923 predicted 429
10 SASI_Mm01_00080924 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002754
VALIDATED
MAPK13 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 13
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-1003s1c1
Sequence:CCGGCCCTCACCCATCCCTTCTTTGCTCGAGCAAAGAAGGGATGGGTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-1091s1c1
Sequence:CCGGGAAACTCACAGTGGATGAATGCTCGAGCATTCATCCACTGTGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-273s1c1
Sequence:CCGGCCCTTTCAGTCCGAGATCTTCCTCGAGGAAGATCTCGGACTGAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-846s1c1
Sequence:CCGGCTGAACGACAAAGCGGCCAAACTCGAGTTTGGCCGCTTTGTCGTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-568s1c1
Sequence:CCGGCTGTGAATGAGGACTGTGAACCTCGAGGTTCACAGTCCTCATTCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.x-1061s1c1
Sequence:CCGGGCAGCCGTTTGATGATTCCTTCTCGAGAAGGAATCATCAAACGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-1065s1c1
Sequence:CCGGCCGTTTGATGATTCCTTAGAACTCGAGTTCTAAGGAATCATCAAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-389s1c1
Sequence:CCGGGCGCAACTTCTATGACTTCTACTCGAGTAGAAGTCATAGAAGTTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-720s1c1
Sequence:CCGGTCTGTGGGCTGTATCATGGCACTCGAGTGCCATGATACAGCCCACAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.x-847s1c1
Sequence:CCGGTGAACGACAAAGCGGCCAAATCTCGAGATTTGGCCGCTTTGTCGTTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002754.x-1254s1c1
Sequence:CCGGCTACCAAACTCAGCCCTTCTTCTCGAGAAGAAGGGCTGAGTTTGGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-826s1c1
Sequence:CCGGGCACGGAGTTTGTGCAGAAGCCTCGAGGCTTCTGCACAAACTCCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002754.3-1381s1c1
Sequence:CCGGGATCCTAACAGGCCACGTTAACTCGAGTTAACGTGGCCTGTTAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.3-497s1c1
Sequence:CCGGGATGCTCAAAGGCCTTAAGTACTCGAGTACTTAAGGCCTTTGAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-680s1c1
Sequence:CCGGCCTCAGCTGGATGCACTACAACTCGAGTTGTAGTGCATCCAGCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-1115s1c1
Sequence:CCGGGCAGCACATCTACAAGGAGATCTCGAGATCTCCTTGTAGATGTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-326s1c1
Sequence:CCGGGAAGCACATGCAGCATGAGAACTCGAGTTCTCATGCTGCATGTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002754
VALIDATED
MAPK13 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 13
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-1003s1c1
Sequence:CCGGCCCTCACCCATCCCTTCTTTGCTCGAGCAAAGAAGGGATGGGTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-1091s1c1
Sequence:CCGGGAAACTCACAGTGGATGAATGCTCGAGCATTCATCCACTGTGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-273s1c1
Sequence:CCGGCCCTTTCAGTCCGAGATCTTCCTCGAGGAAGATCTCGGACTGAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-846s1c1
Sequence:CCGGCTGAACGACAAAGCGGCCAAACTCGAGTTTGGCCGCTTTGTCGTTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-568s1c1
Sequence:CCGGCTGTGAATGAGGACTGTGAACCTCGAGGTTCACAGTCCTCATTCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.x-1061s1c1
Sequence:CCGGGCAGCCGTTTGATGATTCCTTCTCGAGAAGGAATCATCAAACGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-1065s1c1
Sequence:CCGGCCGTTTGATGATTCCTTAGAACTCGAGTTCTAAGGAATCATCAAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-389s1c1
Sequence:CCGGGCGCAACTTCTATGACTTCTACTCGAGTAGAAGTCATAGAAGTTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-720s1c1
Sequence:CCGGTCTGTGGGCTGTATCATGGCACTCGAGTGCCATGATACAGCCCACAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.x-847s1c1
Sequence:CCGGTGAACGACAAAGCGGCCAAATCTCGAGATTTGGCCGCTTTGTCGTTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002754.x-1254s1c1
Sequence:CCGGCTACCAAACTCAGCCCTTCTTCTCGAGAAGAAGGGCTGAGTTTGGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-826s1c1
Sequence:CCGGGCACGGAGTTTGTGCAGAAGCCTCGAGGCTTCTGCACAAACTCCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002754.3-1381s1c1
Sequence:CCGGGATCCTAACAGGCCACGTTAACTCGAGTTAACGTGGCCTGTTAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.3-497s1c1
Sequence:CCGGGATGCTCAAAGGCCTTAAGTACTCGAGTACTTAAGGCCTTTGAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-680s1c1
Sequence:CCGGCCTCAGCTGGATGCACTACAACTCGAGTTGTAGTGCATCCAGCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-1115s1c1
Sequence:CCGGGCAGCACATCTACAAGGAGATCTCGAGATCTCCTTGTAGATGTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-326s1c1
Sequence:CCGGGAAGCACATGCAGCATGAGAACTCGAGTTCTCATGCTGCATGTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002754
VALIDATED
MAPK13 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 13
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-1003s1c1
Sequence:CCGGCCCTCACCCATCCCTTCTTTGCTCGAGCAAAGAAGGGATGGGTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-1091s1c1
Sequence:CCGGGAAACTCACAGTGGATGAATGCTCGAGCATTCATCCACTGTGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-273s1c1
Sequence:CCGGCCCTTTCAGTCCGAGATCTTCCTCGAGGAAGATCTCGGACTGAAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-846s1c1
Sequence:CCGGCTGAACGACAAAGCGGCCAAACTCGAGTTTGGCCGCTTTGTCGTTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-568s1c1
Sequence:CCGGCTGTGAATGAGGACTGTGAACCTCGAGGTTCACAGTCCTCATTCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.x-1061s1c1
Sequence:CCGGGCAGCCGTTTGATGATTCCTTCTCGAGAAGGAATCATCAAACGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-1065s1c1
Sequence:CCGGCCGTTTGATGATTCCTTAGAACTCGAGTTCTAAGGAATCATCAAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-389s1c1
Sequence:CCGGGCGCAACTTCTATGACTTCTACTCGAGTAGAAGTCATAGAAGTTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.x-720s1c1
Sequence:CCGGTCTGTGGGCTGTATCATGGCACTCGAGTGCCATGATACAGCCCACAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.x-847s1c1
Sequence:CCGGTGAACGACAAAGCGGCCAAATCTCGAGATTTGGCCGCTTTGTCGTTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002754.x-1254s1c1
Sequence:CCGGCTACCAAACTCAGCCCTTCTTCTCGAGAAGAAGGGCTGAGTTTGGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-826s1c1
Sequence:CCGGGCACGGAGTTTGTGCAGAAGCCTCGAGGCTTCTGCACAAACTCCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002754.3-1381s1c1
Sequence:CCGGGATCCTAACAGGCCACGTTAACTCGAGTTAACGTGGCCTGTTAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002754.3-497s1c1
Sequence:CCGGGATGCTCAAAGGCCTTAAGTACTCGAGTACTTAAGGCCTTTGAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-680s1c1
Sequence:CCGGCCTCAGCTGGATGCACTACAACTCGAGTTGTAGTGCATCCAGCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-1115s1c1
Sequence:CCGGGCAGCACATCTACAAGGAGATCTCGAGATCTCCTTGTAGATGTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002754.3-326s1c1
Sequence:CCGGGAAGCACATGCAGCATGAGAACTCGAGTTCTCATGCTGCATGTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011950
VALIDATED
MAPK13 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 13
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011950.2-482s21c1
Sequence:CCGGTGGTGTACCAGATGCTCAAAGCTCGAGCTTTGAGCATCTGGTACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-1058s1c1
Sequence:CCGGCGAATGGAAACAACACATCTACTCGAGTAGATGTGTTGTTTCCATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-338s1c1
Sequence:CCGGCCTTCGGAGCTTCCATGATTTCTCGAGAAATCATGGAAGCTCCGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011950.2-382s21c1
Sequence:CCGGCTTCGGAGCTTCCATGATTTCCTCGAGGAAATCATGGAAGCTCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-446s1c1
Sequence:CCGGCCAGATGCTCAAAGGTCTAAACTCGAGTTTAGACCTTTGAGCATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011950.1-1030s1c1
Sequence:CCGGCCTTAGAACATGAGAAACTCACTCGAGTGAGTTTCTCATGTTCTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-407s1c1
Sequence:CCGGGATGGAATTCAGCGAGGATAACTCGAGTTATCCTCGCTGAATTCCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011950.2-1117s21c1
Sequence:CCGGATCTACAAAGAGATCTCAAACCTCGAGGTTTGAGATCTCTTTGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011950
VALIDATED
MAPK13 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 13
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011950.2-482s21c1
Sequence:CCGGTGGTGTACCAGATGCTCAAAGCTCGAGCTTTGAGCATCTGGTACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-1058s1c1
Sequence:CCGGCGAATGGAAACAACACATCTACTCGAGTAGATGTGTTGTTTCCATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-338s1c1
Sequence:CCGGCCTTCGGAGCTTCCATGATTTCTCGAGAAATCATGGAAGCTCCGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011950.2-382s21c1
Sequence:CCGGCTTCGGAGCTTCCATGATTTCCTCGAGGAAATCATGGAAGCTCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-446s1c1
Sequence:CCGGCCAGATGCTCAAAGGTCTAAACTCGAGTTTAGACCTTTGAGCATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011950.1-1030s1c1
Sequence:CCGGCCTTAGAACATGAGAAACTCACTCGAGTGAGTTTCTCATGTTCTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-407s1c1
Sequence:CCGGGATGGAATTCAGCGAGGATAACTCGAGTTATCCTCGCTGAATTCCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011950.2-1117s21c1
Sequence:CCGGATCTACAAAGAGATCTCAAACCTCGAGGTTTGAGATCTCTTTGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011950
VALIDATED
MAPK13 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 13
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011950.2-482s21c1
Sequence:CCGGTGGTGTACCAGATGCTCAAAGCTCGAGCTTTGAGCATCTGGTACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-1058s1c1
Sequence:CCGGCGAATGGAAACAACACATCTACTCGAGTAGATGTGTTGTTTCCATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-338s1c1
Sequence:CCGGCCTTCGGAGCTTCCATGATTTCTCGAGAAATCATGGAAGCTCCGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011950.2-382s21c1
Sequence:CCGGCTTCGGAGCTTCCATGATTTCCTCGAGGAAATCATGGAAGCTCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-446s1c1
Sequence:CCGGCCAGATGCTCAAAGGTCTAAACTCGAGTTTAGACCTTTGAGCATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011950.1-1030s1c1
Sequence:CCGGCCTTAGAACATGAGAAACTCACTCGAGTGAGTTTCTCATGTTCTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011950.1-407s1c1
Sequence:CCGGGATGGAATTCAGCGAGGATAACTCGAGTTATCCTCGCTGAATTCCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011950.2-1117s21c1
Sequence:CCGGATCTACAAAGAGATCTCAAACCTCGAGGTTTGAGATCTCTTTGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)