EMAIL THIS PAGE TO A FRIEND

MAPK15

mitogen-activated protein kinase 15

60 Gene Product Result for
Synonyms: ERK7 ERK8
UniProtKB ID: Q8TD08, Q2TCF9, Q8N362
Gene ID:
Mouse(332110) mitogen-activated protein kinase 15
Rat(286997) mitogen-activated protein kinase 15
Zebrafish(553780) mitogen-activated protein kinase 15
chicken(426292) mitogen-activated protein kinase 15
dog(482080) mitogen-activated protein kinase 15
domestic cat(101091508) mitogen-activated protein kinase 15
cow(512125) mitogen-activated protein kinase 15
sheep(101112234) mitogen-activated protein kinase 15
domestic guinea pig(100731353) mitogen-activated protein kinase 15
naked mole-rat(101712538) mitogen-activated protein kinase 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139021 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158631 MISSION® esiRNA esiRNA human MAPK15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139021 Rosetta Predictions human pricing
NM_173331 Rosetta Predictions rat pricing
NM_177922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098496 predicted 451
2 SASI_Hs01_00098497 predicted 288
3 SASI_Hs01_00098498 predicted 214
4 SASI_Hs01_00098499 predicted 1615
5 SASI_Hs01_00098500 predicted 201
6 SASI_Hs01_00098501 predicted 1053
7 SASI_Hs01_00098502 predicted 1578
8 SASI_Hs01_00098504 predicted 866
9 SASI_Hs01_00098505 predicted 1037
10 SASI_Hs02_00364062 predicted 1602
11 SASI_Hs01_00098503 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043977 predicted 422
2 SASI_Rn01_00043978 predicted 290
3 SASI_Rn01_00043979 predicted 1228
4 SASI_Rn01_00043980 predicted 892
5 SASI_Rn01_00043981 predicted 279
6 SASI_Rn01_00043982 predicted 1033
7 SASI_Rn01_00043983 predicted 1544
8 SASI_Rn01_00043984 predicted 1258
9 SASI_Rn01_00043985 predicted 375
10 SASI_Rn01_00043986 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066914 predicted 1087
2 SASI_Mm01_00066915 predicted 262
3 SASI_Mm01_00066916 predicted 349
4 SASI_Mm01_00066917 predicted 1603
5 SASI_Mm01_00066918 predicted 1113
6 SASI_Mm01_00066919 predicted 330
7 SASI_Mm01_00066920 predicted 856
8 SASI_Mm01_00066921 predicted 844
9 SASI_Mm01_00066922 predicted 317
10 SASI_Mm01_00066923 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139021
VALIDATED
MAPK15 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 15
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-200s1c1
Sequence:CCGGCCAGAGAACATTCCGGGAAATCTCGAGATTTCCCGGAATGTTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-294s1c1
Sequence:CCGGAGGGACATTTACCTGGTGTTTCTCGAGAAACACCAGGTAAATGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139021.1-507s1c1
Sequence:CCGGCCGTCCAATGTGCTCCTGGATCTCGAGATCCAGGAGCACATTGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-282s1c1
Sequence:CCGGGCAGAGAACGACAGGGACATTCTCGAGAATGTCCCTGTCGTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-653s1c1
Sequence:CCGGGCTGCTCTCTTCGCACCGATACTCGAGTATCGGTGCGAAGAGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.x-284s1c1
Sequence:CCGGAGAGAACGACAGGGACATTTACTCGAGTAAATGTCCCTGTCGTTCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.x-187s1c1
Sequence:CCGGATAAGACAGATGCCCAGAGAACTCGAGTTCTCTGGGCATCTGTCTTATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139021.x-2203s1c1
Sequence:CCGGCCACTGACTTCCTCCAATAAACTCGAGTTTATTGGAGGAAGTCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.2-108s1c1
Sequence:CCGGGCCTATGGCATTGTGTGGAAGCTCGAGCTTCCACACAATGCCATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.2-1299s1c1
Sequence:CCGGCAAACTGCTCTCCTAGGGAATCTCGAGATTCCCTAGGAGAGCAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139021.2-1535s1c1
Sequence:CCGGCCGGAGGATGTTCAGCACCTCCTCGAGGAGGTGCTGAACATCCTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139021.2-329s1c1
Sequence:CCGGCACTGACCTGAACGCAGTCATCTCGAGATGACTGCGTTCAGGTCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.2-1612s1c1
Sequence:CCGGCCTACGGGACTGTCTGCCACTCTCGAGAGTGGCAGACAGTCCCGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139021.2-1051s1c1
Sequence:CCGGGCCGCGTCTATCAGATGATCCCTCGAGGGATCATCTGATAGACGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-459s21c1
Sequence:CCGGCCGTCCAATGTGCTCCTGGATCTCGAGATCCAGGAGCACATTGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-329s21c1
Sequence:CCGGCACTGACCTGAACGCAGTCATCTCGAGATGACTGCGTTCAGGTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-305s21c1
Sequence:CCGGTTACCTGGTGTTTGAGTTTATCTCGAGATAAACTCAAACACCAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-195s21c1
Sequence:CCGGACAGATGCCCAGAGAACATTCCTCGAGGAATGTTCTCTGGGCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-1051s21c1
Sequence:CCGGGCCGCGTCTATCAGATGATCCCTCGAGGGATCATCTGATAGACGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139021
VALIDATED
MAPK15 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 15
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-200s1c1
Sequence:CCGGCCAGAGAACATTCCGGGAAATCTCGAGATTTCCCGGAATGTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-294s1c1
Sequence:CCGGAGGGACATTTACCTGGTGTTTCTCGAGAAACACCAGGTAAATGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139021.1-507s1c1
Sequence:CCGGCCGTCCAATGTGCTCCTGGATCTCGAGATCCAGGAGCACATTGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-282s1c1
Sequence:CCGGGCAGAGAACGACAGGGACATTCTCGAGAATGTCCCTGTCGTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-653s1c1
Sequence:CCGGGCTGCTCTCTTCGCACCGATACTCGAGTATCGGTGCGAAGAGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.x-284s1c1
Sequence:CCGGAGAGAACGACAGGGACATTTACTCGAGTAAATGTCCCTGTCGTTCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.x-187s1c1
Sequence:CCGGATAAGACAGATGCCCAGAGAACTCGAGTTCTCTGGGCATCTGTCTTATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139021.x-2203s1c1
Sequence:CCGGCCACTGACTTCCTCCAATAAACTCGAGTTTATTGGAGGAAGTCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.2-108s1c1
Sequence:CCGGGCCTATGGCATTGTGTGGAAGCTCGAGCTTCCACACAATGCCATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.2-1299s1c1
Sequence:CCGGCAAACTGCTCTCCTAGGGAATCTCGAGATTCCCTAGGAGAGCAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139021.2-1535s1c1
Sequence:CCGGCCGGAGGATGTTCAGCACCTCCTCGAGGAGGTGCTGAACATCCTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139021.2-329s1c1
Sequence:CCGGCACTGACCTGAACGCAGTCATCTCGAGATGACTGCGTTCAGGTCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.2-1612s1c1
Sequence:CCGGCCTACGGGACTGTCTGCCACTCTCGAGAGTGGCAGACAGTCCCGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139021.2-1051s1c1
Sequence:CCGGGCCGCGTCTATCAGATGATCCCTCGAGGGATCATCTGATAGACGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-459s21c1
Sequence:CCGGCCGTCCAATGTGCTCCTGGATCTCGAGATCCAGGAGCACATTGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-329s21c1
Sequence:CCGGCACTGACCTGAACGCAGTCATCTCGAGATGACTGCGTTCAGGTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-305s21c1
Sequence:CCGGTTACCTGGTGTTTGAGTTTATCTCGAGATAAACTCAAACACCAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-195s21c1
Sequence:CCGGACAGATGCCCAGAGAACATTCCTCGAGGAATGTTCTCTGGGCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-1051s21c1
Sequence:CCGGGCCGCGTCTATCAGATGATCCCTCGAGGGATCATCTGATAGACGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139021
VALIDATED
MAPK15 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 15
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-200s1c1
Sequence:CCGGCCAGAGAACATTCCGGGAAATCTCGAGATTTCCCGGAATGTTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-294s1c1
Sequence:CCGGAGGGACATTTACCTGGTGTTTCTCGAGAAACACCAGGTAAATGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139021.1-507s1c1
Sequence:CCGGCCGTCCAATGTGCTCCTGGATCTCGAGATCCAGGAGCACATTGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-282s1c1
Sequence:CCGGGCAGAGAACGACAGGGACATTCTCGAGAATGTCCCTGTCGTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.1-653s1c1
Sequence:CCGGGCTGCTCTCTTCGCACCGATACTCGAGTATCGGTGCGAAGAGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.x-284s1c1
Sequence:CCGGAGAGAACGACAGGGACATTTACTCGAGTAAATGTCCCTGTCGTTCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.x-187s1c1
Sequence:CCGGATAAGACAGATGCCCAGAGAACTCGAGTTCTCTGGGCATCTGTCTTATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139021.x-2203s1c1
Sequence:CCGGCCACTGACTTCCTCCAATAAACTCGAGTTTATTGGAGGAAGTCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.2-108s1c1
Sequence:CCGGGCCTATGGCATTGTGTGGAAGCTCGAGCTTCCACACAATGCCATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.2-1299s1c1
Sequence:CCGGCAAACTGCTCTCCTAGGGAATCTCGAGATTCCCTAGGAGAGCAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139021.2-1535s1c1
Sequence:CCGGCCGGAGGATGTTCAGCACCTCCTCGAGGAGGTGCTGAACATCCTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139021.2-329s1c1
Sequence:CCGGCACTGACCTGAACGCAGTCATCTCGAGATGACTGCGTTCAGGTCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139021.2-1612s1c1
Sequence:CCGGCCTACGGGACTGTCTGCCACTCTCGAGAGTGGCAGACAGTCCCGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_139021.2-1051s1c1
Sequence:CCGGGCCGCGTCTATCAGATGATCCCTCGAGGGATCATCTGATAGACGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-459s21c1
Sequence:CCGGCCGTCCAATGTGCTCCTGGATCTCGAGATCCAGGAGCACATTGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-329s21c1
Sequence:CCGGCACTGACCTGAACGCAGTCATCTCGAGATGACTGCGTTCAGGTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-305s21c1
Sequence:CCGGTTACCTGGTGTTTGAGTTTATCTCGAGATAAACTCAAACACCAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-195s21c1
Sequence:CCGGACAGATGCCCAGAGAACATTCCTCGAGGAATGTTCTCTGGGCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139021.2-1051s21c1
Sequence:CCGGGCCGCGTCTATCAGATGATCCCTCGAGGGATCATCTGATAGACGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177922
MAPK15 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 15
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-322s1c1
Sequence:CCGGGCTTGATGTAATCCCAGCGAACTCGAGTTCGCTGGGATTACATCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-339s1c1
Sequence:CCGGCGAAGAATGACAGGGATATTTCTCGAGAAATATCCCTGTCATTCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-515s1c1
Sequence:CCGGGCCAATGTTCTACTGGATTCTCTCGAGAGAATCCAGTAGAACATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-1597s1c1
Sequence:CCGGCGGCCGAAGGATGTTTGGCATCTCGAGATGCCAAACATCCTTCGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-1113s1c1
Sequence:CCGGACCAGATTATCCTGGAGCAAACTCGAGTTTGCTCCAGGATAATCTGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177922.2-258s21c1
Sequence:CCGGAGAGGACCTTCCGTGAGATTACTCGAGTAATCTCACGGAAGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177922.2-340s21c1
Sequence:CCGGGAAGAATGACAGGGATATTTACTCGAGTAAATATCCCTGTCATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177922.2-1102s21c1
Sequence:CCGGCAAACGCCTGTACCAGATTATCTCGAGATAATCTGGTACAGGCGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177922
MAPK15 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 15
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-322s1c1
Sequence:CCGGGCTTGATGTAATCCCAGCGAACTCGAGTTCGCTGGGATTACATCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-339s1c1
Sequence:CCGGCGAAGAATGACAGGGATATTTCTCGAGAAATATCCCTGTCATTCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-515s1c1
Sequence:CCGGGCCAATGTTCTACTGGATTCTCTCGAGAGAATCCAGTAGAACATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-1597s1c1
Sequence:CCGGCGGCCGAAGGATGTTTGGCATCTCGAGATGCCAAACATCCTTCGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-1113s1c1
Sequence:CCGGACCAGATTATCCTGGAGCAAACTCGAGTTTGCTCCAGGATAATCTGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177922.2-258s21c1
Sequence:CCGGAGAGGACCTTCCGTGAGATTACTCGAGTAATCTCACGGAAGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177922.2-340s21c1
Sequence:CCGGGAAGAATGACAGGGATATTTACTCGAGTAAATATCCCTGTCATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177922.2-1102s21c1
Sequence:CCGGCAAACGCCTGTACCAGATTATCTCGAGATAATCTGGTACAGGCGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177922
MAPK15 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 15
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-322s1c1
Sequence:CCGGGCTTGATGTAATCCCAGCGAACTCGAGTTCGCTGGGATTACATCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-339s1c1
Sequence:CCGGCGAAGAATGACAGGGATATTTCTCGAGAAATATCCCTGTCATTCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-515s1c1
Sequence:CCGGGCCAATGTTCTACTGGATTCTCTCGAGAGAATCCAGTAGAACATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-1597s1c1
Sequence:CCGGCGGCCGAAGGATGTTTGGCATCTCGAGATGCCAAACATCCTTCGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177922.2-1113s1c1
Sequence:CCGGACCAGATTATCCTGGAGCAAACTCGAGTTTGCTCCAGGATAATCTGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177922.2-258s21c1
Sequence:CCGGAGAGGACCTTCCGTGAGATTACTCGAGTAATCTCACGGAAGGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177922.2-340s21c1
Sequence:CCGGGAAGAATGACAGGGATATTTACTCGAGTAAATATCCCTGTCATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177922.2-1102s21c1
Sequence:CCGGCAAACGCCTGTACCAGATTATCTCGAGATAATCTGGTACAGGCGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)