EMAIL THIS PAGE TO A FRIEND

MAPK1

mitogen-activated protein kinase 1

141 Gene Product Result for
Synonyms: ERK ERK2 ERT1 MAPK2 P42MAPK PRKM1 PRKM2 p38 p40 p41 p41mapk
UniProtKB ID: P28482
Gene ID:
Human(5594) Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The activation of this kinase requires its phosphorylation by upstream kinases. Upon activation, this kinase translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. Two alternatively spliced transcript variants encoding the same protein, but differing in the UTRs, have been reported for this gene. [provided by RefSeq, Jul 2008]
Mouse(26413) mitogen-activated protein kinase 1
Rat(116590) mitogen activated protein kinase 1
Zebrafish(360144) mitogen-activated protein kinase 1
domestic cat(101087614) mitogen-activated protein kinase 1
cow(327672) mitogen-activated protein kinase 1
dog(477575) mitogen-activated protein kinase 1
chicken(373953) mitogen-activated protein kinase 1
sheep(101115485) mitogen-activated protein kinase 1
domestic guinea pig(100715180) mitogen-activated protein kinase 1
naked mole-rat(101706099) mitogen-activated protein kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500365 Anti-ERK2/MAPK1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, chimpanzee, chicken, Xenopus, bovine, mouse
ELISA, western blot pricing
M5670 Anti-MAP Kinase (ERK-1, ERK-2) antibody produced in rabbit whole antiserum human, rat, mouse
microarray, western blot pricing
M7556 Anti-MAP Kinase 2 (ERK-2) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution, ~1 mg/mL human, mouse, rat
immunoprecipitation (IP), western blot pricing
M9692 Anti-MAP Kinase, Activated (Diphosphorylated ERK-1&2) antibody, Mouse monoclonal clone MAPK-YT, purified from hybridoma cell culture yeast, Xenopus, human, rat, bovine, Caenorhabditis elegans, Drosophila, hamster, mouse
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
GW22768 Anti-MAPK1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
HPA030069 Anti-MAPK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
M0800 Anti-p38 MAP Kinase antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse
microarray, western blot pricing
SAB4502391 Anti-P42 MAPK antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
M7683 Anti-phospho-MAP Kinase Kinase 1/2 (pSer217/221) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4504395 Anti-phospho-p44/42 MAP Kinase (pThr202) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4504396 Anti-phospho-p44/42 MAP Kinase (pTyr204) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1305558 MONOCLONAL ANTI-ERK2 antibody produced in mouse clone 814CT5.4.2, IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
M7431 Monoclonal Anti-MAP Kinase 2 (ERK-2) antibody produced in mouse clone 1B3B9, purified immunoglobulin, buffered aqueous solution mouse, rat, human
immunoprecipitation (IP), microarray, western blot pricing
M8159 Monoclonal Anti-MAP Kinase, Activated (Diphosphorylated ERK-1&2) antibody produced in mouse clone MAPK-YT, ascites fluid yeast, Xenopus, human, rat, bovine, Caenorhabditis elegans, Drosophila, hamster, mouse
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
F7776 Monoclonal Anti-MAP Kinase, Activated (Diphosphorylated ERK-1&2)−FITC antibody produced in mouse clone MAPK-YT, purified immunoglobulin, buffered aqueous solution yeast, Xenopus, human, rat, bovine, Caenorhabditis elegans, Drosophila, hamster, mouse
immunofluorescence pricing
M7802 Monoclonal Anti-MAP Kinase, Activated/monophosphorylated (Phosphothreonine ERK-1&2) antibody produced in mouse ~2 mg/mL, clone ERK-PT115, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, immunocytochemistry, microarray, western blot pricing
M3557 Monoclonal Anti-MAP Kinase, Monophosphorylated Threonine antibody produced in mouse ~2 mg/mL, clone ERK-YNP, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, microarray, western blot pricing
M3682 Monoclonal Anti-MAP Kinase, Monophosphorylated Tyrosine antibody produced in mouse ~2 mg/mL, clone ERK-PY193, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunocytochemistry, microarray, western blot pricing
M3807 Monoclonal Anti-MAP Kinase, Non-Phosphorylated ERK antibody produced in mouse ~2 mg/mL, clone ERK-NP2, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, immunocytochemistry, microarray, western blot pricing
WH0005594M1 Monoclonal Anti-MAPK1 antibody produced in mouse clone 1D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing
PLA0236 Rabbit anti-ERK2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, rat, horse, bovine, human, pig, mouse, turkey, chicken, primate, rabbit, guinea pig
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A8626 Adenine ≥99% human, mouse, rat pricing
A2786 Adenine suitable for cell culture, BioReagent human, mouse, rat pricing
A5665 Adenine BioReagent, plant cell culture tested, ≥99% human, mouse, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB0958 Phosphotyrosine MAPK1 / MAPK3 ELISA Kit human pricing

Kits

Product # Description Species Add to Cart
 
PE0100 phospho-ERK 1&2 (pThr185/pTyr187) ELISA sufficient for 96 tests human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0752 AQUA Peptide VADPDHDHTGFLTE(pY)VAT[R] human, mouse, rat pricing
AQ0750 AQUA Peptide VADPDHDHTGFLTEYVAT[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138957 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044171 MISSION® esiRNA esiRNA human MAPK1 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
16-284 Anti-MAP Kinase 1/2 (Erk1/2) Antibody, CT, Alexa Fluor® 555 conjugate This Anti-MAP Kinase 1/2 (Erk1/2) Antibody, CT, Alexa Fluor 555 conjugate is validated for use in FC, IC, IF, WB for the detection of MAP Kinase 1/2 (Erk1/2). pricing
06-333 Anti-MAP Kinase 2/Erk2 Antibody Anti-MAP Kinase 2/Erk2 Antibody detects level of MAP Kinase 2/Erk2 & has been published & validated for use in IP & WB. pricing
05-157 Anti-MAP Kinase 2/Erk2 Antibody, clone 1B3B9 Anti-MAP Kinase 2/Erk2 Antibody, clone 1B3B9 is an antibody against MAP Kinase 2/Erk2 for use in IP & WB. pricing
ABS44 Anti-MAPK 1/2 Antibody Detect MAPK 3/MAPK 1 (ERK1/ERK2) using this Anti-MAPK 1/2 Antibody validated for use in Immunocytochemistry, Immunoprecipitation, and Western Blotting. pricing
05-797R Anti-phospho-Erk1/2 (Thr202/Tyr204, Thr185/Tyr187)Antibody, recombinant clone AW39R, rabbit monoclonal Anti-phospho-Erk1/2 (Thr202/Tyr204 Antibody, Thr185/Tyr187), recombinant clone AW39R detects level of phospho-Erk1/2 (Thr202/Tyr204 & has been published & validated for use in Mplex & WB. pricing
04-797 Anti-phospho-MAP Kinase 1/2 (Erk1/2)(Thr185/Tyr187) Antibody, clone AW39 pricing
14-439-M MAP Kinase 1/Erk1 Protein, active, 10 µg Active, recombinant, full-length, human MAP Kinase 1/Erk1 containing an N-terminal GST tag, for use in Kinase Assays. pricing
14-515 MAP Kinase 1/Erk1 Protein, unactive, 50 µg Unactive, N-terminal GST-tagged, recombinant, full-length, human MAP Kinase 1/Erk1, for use in Kinase Assays. pricing
14-550-M MAP Kinase 2/Erk2 Protein, active, Human, 10 µg Active, N-terminal GST tagged, recombinant, full-length, human MAP Kinase 2/Erk2. Activated with MEK1 (Cat. # 14-429). For use in Kinase Assays. pricing
14-173-M MAP Kinase 2/Erk2 Protein, active, mouse, 10 µg Active, N-terminal GST-tagged, recombinant MAP Kinase 2, expressed in E. coli cells, activated using MEK1 (Catalog #14-429). For use in Kinase Assays. pricing
14-536 MAP Kinase 2/Erk2 Protein, unactive, Human, 50 µg Unactive, N-terminal GST-tagged, recombinant human full length MAP Kinase 2, for use in Kinase Assays. pricing
14-198 MAP Kinase 2/Erk2 Protein, unactive, Mouse, 50 µg Unactive, recombinant full-length mouse p42 MAP Kinase 2/Erk2 fused with GST at the N terminus, for use in Kinase Assays. pricing
17-191 MAP Kinase/Erk Assay Kit, non-radioactive MAP Kinase/Erk Assay Kit is designed to measure the phosphotransferase activity of MAP (mitogen-activated protein) Kinase in immunoprecipitates & column fractions. pricing
15-107 MAPK Pathway 1 Explorer Antibody MiniPack This Antibody pack contains Anti-phospho-Raf-1 Antibody(Ser338), Anti-phospho-MEK1 Antibody(Ser218/222)/ MEK2 (Ser222/226), Anti-phospho-Erk 1/2 Antibody (Thr202/Tyr204, Thr185/Tyr187), validated for use in IF, Flow, WB, Multiplexing pricing
FCABS319PE Milli-Mark Anti-MAP Kinase 1/2 (Erk1/2) Antibody, CT -PE This Milli-Mark Anti-MAP Kinase 1/2 (Erk1/2) Antibody, CT -PE is validated for use in FC for the detection of MAP Kinase 1/2 (Erk1/2). pricing
FCABS165A6 Milli-Mark™ Anti-MAPK 1/2 (tERK) Antibody, Alexa Fluor 647 Conjugate Milli-Mark Anti-MAPK 1/2 (tERK) Antibody, Alexa Fluor 647 Conjugate detects level of MAPK 1/2 (tERK) & has been published & validated for use in FC. pricing
FCMAB100P Milli-Mark Anti-Phospho-Erk1/2 Antibody (Thr202/Tyr204, Thr185/Tyr187)-PE This Milli-Mark Phospho-Erk1/2 antibody is validated for use in Flow & WB for the detection of the Milli-Mark Phospho-Erk1/2 protein. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002745 Rosetta Predictions human pricing
NM_138957 Rosetta Predictions human pricing
NM_053842 Rosetta Predictions rat pricing
NM_001038663 Rosetta Predictions mouse pricing
NM_011949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124656 predicted 586
2 SASI_Hs01_00124657 predicted 659
3 SASI_Hs01_00124658 predicted 514
4 SASI_Hs01_00124660 predicted 567
5 SASI_Hs01_00124661 predicted 714
6 SASI_Hs01_00124662 predicted 563
7 SASI_Hs01_00124663 predicted 525
8 SASI_Hs01_00124664 predicted 918
9 SASI_Hs01_00124665 predicted 983
10 SASI_Hs02_00334354 predicted 782
11 SASI_Hs01_00124659 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075813 predicted 662
2 SASI_Hs01_00075814 predicted 510
3 SASI_Hs01_00075816 predicted 569
4 SASI_Hs01_00075817 predicted 712
5 SASI_Hs01_00075818 predicted 565
6 SASI_Hs01_00075819 predicted 518
7 SASI_Hs01_00075820 predicted 913
8 SASI_Hs01_00075821 predicted 982
9 SASI_Hs02_00364006 predicted 789
10 SASI_Hs01_00075815 predicted 488
11 SASI_Hs01_00075812 positive 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107865 predicted 909
2 SASI_Rn02_00266690 predicted 487
3 SASI_Rn01_00107867 predicted 1064
4 SASI_Rn01_00107868 predicted 435
5 SASI_Rn01_00107869 predicted 1231
6 SASI_Rn02_00266691 predicted 417
7 SASI_Rn01_00107871 predicted 522
8 SASI_Rn01_00107872 predicted 939
9 SASI_Rn01_00107873 predicted 1103
10 SASI_Rn02_00266692 predicted 916
11 SASI_Rn01_00107866 positive 581
12 SASI_Rn01_00107870 predicted 495
13 SASI_Rn01_00107874 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131769 predicted 979
2 SASI_Mm01_00131770 predicted 825
3 SASI_Mm02_00289667 predicted 512
4 SASI_Mm01_00131771 predicted 962
5 SASI_Mm02_00289668 predicted 1009
6 SASI_Mm01_00131772 predicted 665
7 SASI_Mm01_00131774 predicted 841
8 SASI_Mm01_00131775 predicted 480
9 SASI_Mm01_00131776 predicted 1017
10 SASI_Mm01_00131778 predicted 846
11 SASI_Mm01_00131773 predicted 1085
12 SASI_Mm01_00131777 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143354 predicted 976
2 SASI_Mm01_00143355 predicted 825
3 SASI_Mm02_00321814 predicted 512
4 SASI_Mm01_00143356 predicted 956
5 SASI_Mm02_00321815 predicted 1012
6 SASI_Mm01_00143357 predicted 661
7 SASI_Mm01_00143359 predicted 841
8 SASI_Mm01_00143360 predicted 472
9 SASI_Mm01_00143361 predicted 1011
10 SASI_Mm01_00143363 predicted 848
11 SASI_Mm01_00143358 predicted 1089
12 SASI_Mm01_00143362 predicted 959
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011949
VALIDATED
MAPK1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011949.2-921s1c1
Sequence:CCGGGCTGAATCACATCCTGGGTATCTCGAGATACCCAGGATGTGATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-350s1c1
Sequence:CCGGTCAACAAAGTTCGAGTTGCTACTCGAGTAGCAACTCGAACTTTGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-819s1c1
Sequence:CCGGCAAGGGTTATACCAAGTCCATCTCGAGATGGACTTGGTATAACCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011949.2-2498s1c1
Sequence:CCGGGCTGTGGAGTTGATGGTGTTACTCGAGTAACACCATCAACTCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011949.2-1698s1c1
Sequence:CCGGGCTAGGACATAAGGCACCTTACTCGAGTAAGGTGCCTTATGTCCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-1069s1c1
Sequence:CCGGGCTCTGGATTTACTGGATAAACTCGAGTTTATCCAGTAAATCCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-796s1c1
Sequence:CCGGGCTCCAGAAATTATGTTGAATCTCGAGATTCAACATAATTTCTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-401s1c1
Sequence:CCGGCCTACTGTCAAAGAACCCTAACTCGAGTTAGGGTTCTTTGACAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011949.2-490s1c1
Sequence:CCGGCCAACCATTGAGCAAATGAAACTCGAGTTTCATTTGCTCAATGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011949.3-1817s21c1
Sequence:CCGGGGGTATCCCTGGATGGTATTACTCGAGTAATACCATCCAGGGATACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011949.3-1303s21c1
Sequence:CCGGAGCCAGGATACAGATCTTAAACTCGAGTTTAAGATCTGTATCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011949.3-1169s21c1
Sequence:CCGGCCCATACCTGGAGCAGTATTACTCGAGTAATACTGCTCCAGGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011949
VALIDATED
MAPK1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011949.2-921s1c1
Sequence:CCGGGCTGAATCACATCCTGGGTATCTCGAGATACCCAGGATGTGATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-350s1c1
Sequence:CCGGTCAACAAAGTTCGAGTTGCTACTCGAGTAGCAACTCGAACTTTGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-819s1c1
Sequence:CCGGCAAGGGTTATACCAAGTCCATCTCGAGATGGACTTGGTATAACCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011949.2-2498s1c1
Sequence:CCGGGCTGTGGAGTTGATGGTGTTACTCGAGTAACACCATCAACTCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011949.2-1698s1c1
Sequence:CCGGGCTAGGACATAAGGCACCTTACTCGAGTAAGGTGCCTTATGTCCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-1069s1c1
Sequence:CCGGGCTCTGGATTTACTGGATAAACTCGAGTTTATCCAGTAAATCCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-796s1c1
Sequence:CCGGGCTCCAGAAATTATGTTGAATCTCGAGATTCAACATAATTTCTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-401s1c1
Sequence:CCGGCCTACTGTCAAAGAACCCTAACTCGAGTTAGGGTTCTTTGACAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011949.2-490s1c1
Sequence:CCGGCCAACCATTGAGCAAATGAAACTCGAGTTTCATTTGCTCAATGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011949.3-1817s21c1
Sequence:CCGGGGGTATCCCTGGATGGTATTACTCGAGTAATACCATCCAGGGATACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011949.3-1303s21c1
Sequence:CCGGAGCCAGGATACAGATCTTAAACTCGAGTTTAAGATCTGTATCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011949.3-1169s21c1
Sequence:CCGGCCCATACCTGGAGCAGTATTACTCGAGTAATACTGCTCCAGGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011949
VALIDATED
MAPK1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011949.2-921s1c1
Sequence:CCGGGCTGAATCACATCCTGGGTATCTCGAGATACCCAGGATGTGATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-350s1c1
Sequence:CCGGTCAACAAAGTTCGAGTTGCTACTCGAGTAGCAACTCGAACTTTGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-819s1c1
Sequence:CCGGCAAGGGTTATACCAAGTCCATCTCGAGATGGACTTGGTATAACCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011949.2-2498s1c1
Sequence:CCGGGCTGTGGAGTTGATGGTGTTACTCGAGTAACACCATCAACTCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011949.2-1698s1c1
Sequence:CCGGGCTAGGACATAAGGCACCTTACTCGAGTAAGGTGCCTTATGTCCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-1069s1c1
Sequence:CCGGGCTCTGGATTTACTGGATAAACTCGAGTTTATCCAGTAAATCCAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-796s1c1
Sequence:CCGGGCTCCAGAAATTATGTTGAATCTCGAGATTCAACATAATTTCTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011949.2-401s1c1
Sequence:CCGGCCTACTGTCAAAGAACCCTAACTCGAGTTAGGGTTCTTTGACAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011949.2-490s1c1
Sequence:CCGGCCAACCATTGAGCAAATGAAACTCGAGTTTCATTTGCTCAATGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011949.3-1817s21c1
Sequence:CCGGGGGTATCCCTGGATGGTATTACTCGAGTAATACCATCCAGGGATACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011949.3-1303s21c1
Sequence:CCGGAGCCAGGATACAGATCTTAAACTCGAGTTTAAGATCTGTATCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011949.3-1169s21c1
Sequence:CCGGCCCATACCTGGAGCAGTATTACTCGAGTAATACTGCTCCAGGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138957
VALIDATED
MAPK1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138957.x-1238s1c1
Sequence:CCGGTGGAATTGGATGACTTGCCTACTCGAGTAGGCAAGTCATCCAATTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138957.x-381s1c1
Sequence:CCGGCAAAGTTCGAGTAGCTATCAACTCGAGTTGATAGCTACTCGAACTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A-431
TRC Version: 1 Clone ID:NM_138957.x-502s1c1
Sequence:CCGGGACATTATTCGAGCACCAACCCTCGAGGGTTGGTGCTCGAATAATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138957.x-1186s1c1
Sequence:CCGGTATTACGACCCGAGTGACGAGCTCGAGCTCGTCACTCGGGTCGTAATATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138957.x-657s1c1
Sequence:CCGGTATCCATTCAGCTAACGTTCTCTCGAGAGAACGTTAGCTGAATGGATATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A-431
TRC Version: 1 Clone ID:NM_138957.2-1302s1c1
Sequence:CCGGCCAGCCAGGATACAGATCTTACTCGAGTAAGATCTGTATCCTGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138957.2-1333s1c1
Sequence:CCGGGTACCTGGAGTTTAATACAGTCTCGAGACTGTATTAAACTCCAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138957.2-1328s1c1
Sequence:CCGGGTCAGGTACCTGGAGTTTAATCTCGAGATTAAACTCCAGGTACCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A-431
TRC Version: 1 Clone ID:NM_138957.2-1170s1c1
Sequence:CCGGCCCATATCTGGAGCAGTATTACTCGAGTAATACTGCTCCAGATATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138957.2-1330s1c1
Sequence:CCGGCAGGTACCTGGAGTTTAATACCTCGAGGTATTAAACTCCAGGTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138957.2-863s1c1
Sequence:CCGGCCATTGATATTTGGTCTGTAGCTCGAGCTACAGACCAAATATCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-1238s21c1
Sequence:CCGGTGGAATTGGATGACTTGCCTACTCGAGTAGGCAAGTCATCCAATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-1170s21c1
Sequence:CCGGCCCATATCTGGAGCAGTATTACTCGAGTAATACTGCTCCAGATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-657s21c1
Sequence:CCGGTATCCATTCAGCTAACGTTCTCTCGAGAGAACGTTAGCTGAATGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-381s21c1
Sequence:CCGGCAAAGTTCGAGTAGCTATCAACTCGAGTTGATAGCTACTCGAACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138957
VALIDATED
MAPK1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138957.x-1238s1c1
Sequence:CCGGTGGAATTGGATGACTTGCCTACTCGAGTAGGCAAGTCATCCAATTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138957.x-381s1c1
Sequence:CCGGCAAAGTTCGAGTAGCTATCAACTCGAGTTGATAGCTACTCGAACTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A-431
TRC Version: 1 Clone ID:NM_138957.x-502s1c1
Sequence:CCGGGACATTATTCGAGCACCAACCCTCGAGGGTTGGTGCTCGAATAATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138957.x-1186s1c1
Sequence:CCGGTATTACGACCCGAGTGACGAGCTCGAGCTCGTCACTCGGGTCGTAATATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138957.x-657s1c1
Sequence:CCGGTATCCATTCAGCTAACGTTCTCTCGAGAGAACGTTAGCTGAATGGATATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A-431
TRC Version: 1 Clone ID:NM_138957.2-1302s1c1
Sequence:CCGGCCAGCCAGGATACAGATCTTACTCGAGTAAGATCTGTATCCTGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138957.2-1333s1c1
Sequence:CCGGGTACCTGGAGTTTAATACAGTCTCGAGACTGTATTAAACTCCAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138957.2-1328s1c1
Sequence:CCGGGTCAGGTACCTGGAGTTTAATCTCGAGATTAAACTCCAGGTACCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A-431
TRC Version: 1 Clone ID:NM_138957.2-1170s1c1
Sequence:CCGGCCCATATCTGGAGCAGTATTACTCGAGTAATACTGCTCCAGATATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138957.2-1330s1c1
Sequence:CCGGCAGGTACCTGGAGTTTAATACCTCGAGGTATTAAACTCCAGGTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138957.2-863s1c1
Sequence:CCGGCCATTGATATTTGGTCTGTAGCTCGAGCTACAGACCAAATATCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-1238s21c1
Sequence:CCGGTGGAATTGGATGACTTGCCTACTCGAGTAGGCAAGTCATCCAATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-1170s21c1
Sequence:CCGGCCCATATCTGGAGCAGTATTACTCGAGTAATACTGCTCCAGATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-657s21c1
Sequence:CCGGTATCCATTCAGCTAACGTTCTCTCGAGAGAACGTTAGCTGAATGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-381s21c1
Sequence:CCGGCAAAGTTCGAGTAGCTATCAACTCGAGTTGATAGCTACTCGAACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138957
VALIDATED
MAPK1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138957.x-1238s1c1
Sequence:CCGGTGGAATTGGATGACTTGCCTACTCGAGTAGGCAAGTCATCCAATTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138957.x-381s1c1
Sequence:CCGGCAAAGTTCGAGTAGCTATCAACTCGAGTTGATAGCTACTCGAACTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A-431
TRC Version: 1 Clone ID:NM_138957.x-502s1c1
Sequence:CCGGGACATTATTCGAGCACCAACCCTCGAGGGTTGGTGCTCGAATAATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138957.x-1186s1c1
Sequence:CCGGTATTACGACCCGAGTGACGAGCTCGAGCTCGTCACTCGGGTCGTAATATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138957.x-657s1c1
Sequence:CCGGTATCCATTCAGCTAACGTTCTCTCGAGAGAACGTTAGCTGAATGGATATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A-431
TRC Version: 1 Clone ID:NM_138957.2-1302s1c1
Sequence:CCGGCCAGCCAGGATACAGATCTTACTCGAGTAAGATCTGTATCCTGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138957.2-1333s1c1
Sequence:CCGGGTACCTGGAGTTTAATACAGTCTCGAGACTGTATTAAACTCCAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138957.2-1328s1c1
Sequence:CCGGGTCAGGTACCTGGAGTTTAATCTCGAGATTAAACTCCAGGTACCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A-431
TRC Version: 1 Clone ID:NM_138957.2-1170s1c1
Sequence:CCGGCCCATATCTGGAGCAGTATTACTCGAGTAATACTGCTCCAGATATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138957.2-1330s1c1
Sequence:CCGGCAGGTACCTGGAGTTTAATACCTCGAGGTATTAAACTCCAGGTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138957.2-863s1c1
Sequence:CCGGCCATTGATATTTGGTCTGTAGCTCGAGCTACAGACCAAATATCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-1238s21c1
Sequence:CCGGTGGAATTGGATGACTTGCCTACTCGAGTAGGCAAGTCATCCAATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-1170s21c1
Sequence:CCGGCCCATATCTGGAGCAGTATTACTCGAGTAATACTGCTCCAGATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-657s21c1
Sequence:CCGGTATCCATTCAGCTAACGTTCTCTCGAGAGAACGTTAGCTGAATGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138957.2-381s21c1
Sequence:CCGGCAAAGTTCGAGTAGCTATCAACTCGAGTTGATAGCTACTCGAACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)