EMAIL THIS PAGE TO A FRIEND

MAPK1IP1L

mitogen-activated protein kinase 1 interacting protein 1-like

149 Gene Product Result for
Synonyms: C14orf32 MISS c14_5346
UniProtKB ID: Q8NDC0, B2RDD8, Q96BG5
Gene ID:
Mouse(218975) mitogen-activated protein kinase 1 interacting protein 1-like
Rat(361028) mitogen-activated protein kinase 1 interacting protein 1-like
sheep(101118192) mitogen-activated protein kinase 1 interacting protein 1-like
domestic guinea pig(100732393) mitogen-activated protein kinase 1 interacting protein 1-like
naked mole-rat(101703169) mitogen-activated protein kinase 1 interacting protein 1-like
chicken(423556) chromosome 14 open reading frame 32
dog(480329) mitogen-activated protein kinase 1 interacting protein 1-like
cow(540411) mitogen-activated protein kinase 1 interacting protein 1-like
domestic cat(101081227) mitogen-activated protein kinase 1 interacting protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144578 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144578 Rosetta Predictions human pricing
NM_001108373 Rosetta Predictions rat pricing
NM_178684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124846 predicted 1249
2 SASI_Hs01_00124847 predicted 1309
3 SASI_Hs02_00364363 predicted 973
4 SASI_Hs01_00124848 predicted 1127
5 SASI_Hs02_00364364 predicted 498
6 SASI_Hs01_00124849 predicted 1244
7 SASI_Hs01_00124850 predicted 1145
8 SASI_Hs01_00124852 predicted 1043
9 SASI_Hs01_00124853 predicted 1185
10 SASI_Hs01_00124854 predicted 1162
11 SASI_Hs01_00124851 predicted 1034
12 SASI_Hs01_00124855 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238029 predicted 888
2 SASI_Rn02_00238030 predicted 496
3 SASI_Rn02_00238031 predicted 961
4 SASI_Rn02_00238032 predicted 833
5 SASI_Rn02_00238033 predicted 903
6 SASI_Rn02_00238034 predicted 758
7 SASI_Rn02_00238035 predicted 275
8 SASI_Rn02_00238036 predicted 997
9 SASI_Rn02_00238037 predicted 908
10 SASI_Rn02_00238038 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158795 predicted 574
2 SASI_Mm01_00158796 predicted 988
3 SASI_Mm01_00158797 predicted 883
4 SASI_Mm01_00158798 predicted 985
5 SASI_Mm01_00158799 predicted 436
6 SASI_Mm01_00158800 predicted 926
7 SASI_Mm01_00158801 predicted 1025
8 SASI_Mm02_00349160 predicted 1043
9 SASI_Mm01_00158802 predicted 1016
10 SASI_Mm02_00349161 predicted 1008
11 SASI_Mm01_00158803 predicted 1043
12 SASI_Mm01_00158804 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178684
VALIDATED
MAPK1IP1L MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 1 interacting protein 1-like
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178684.2-1544s1c1
Sequence:CCGGGCCTTCTTCTTTCCTTTCTTTCTCGAGAAAGAAAGGAAAGAAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178684.5-2167s21c1
Sequence:CCGGTTTGGCAGAACTAGGTATAATCTCGAGATTATACCTAGTTCTGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-2960s21c1
Sequence:CCGGGGTCTTAAAGGAGTCAATTATCTCGAGATAATTGACTCCTTTAAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-1704s21c1
Sequence:CCGGGGTGGTTCATTTCTATCATTACTCGAGTAATGATAGAAATGAACCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-3891s21c1
Sequence:CCGGGGTGTTGCATGCCGTTGATATCTCGAGATATCAACGGCATGCAACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-3259s21c1
Sequence:CCGGTCAGTGGTTGCCTACACTTATCTCGAGATAAGTGTAGGCAACCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178684
VALIDATED
MAPK1IP1L MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 1 interacting protein 1-like
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178684.2-1544s1c1
Sequence:CCGGGCCTTCTTCTTTCCTTTCTTTCTCGAGAAAGAAAGGAAAGAAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178684.5-2167s21c1
Sequence:CCGGTTTGGCAGAACTAGGTATAATCTCGAGATTATACCTAGTTCTGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-2960s21c1
Sequence:CCGGGGTCTTAAAGGAGTCAATTATCTCGAGATAATTGACTCCTTTAAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-1704s21c1
Sequence:CCGGGGTGGTTCATTTCTATCATTACTCGAGTAATGATAGAAATGAACCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-3891s21c1
Sequence:CCGGGGTGTTGCATGCCGTTGATATCTCGAGATATCAACGGCATGCAACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-3259s21c1
Sequence:CCGGTCAGTGGTTGCCTACACTTATCTCGAGATAAGTGTAGGCAACCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178684
VALIDATED
MAPK1IP1L MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 1 interacting protein 1-like
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178684.2-1544s1c1
Sequence:CCGGGCCTTCTTCTTTCCTTTCTTTCTCGAGAAAGAAAGGAAAGAAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178684.5-2167s21c1
Sequence:CCGGTTTGGCAGAACTAGGTATAATCTCGAGATTATACCTAGTTCTGCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-2960s21c1
Sequence:CCGGGGTCTTAAAGGAGTCAATTATCTCGAGATAATTGACTCCTTTAAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-1704s21c1
Sequence:CCGGGGTGGTTCATTTCTATCATTACTCGAGTAATGATAGAAATGAACCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-3891s21c1
Sequence:CCGGGGTGTTGCATGCCGTTGATATCTCGAGATATCAACGGCATGCAACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178684.5-3259s21c1
Sequence:CCGGTCAGTGGTTGCCTACACTTATCTCGAGATAAGTGTAGGCAACCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144578
VALIDATED
MAPK1IP1L MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 1 interacting protein 1-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-181s1c1
Sequence:CCGGCCTCTGCTGTGAGCAATACAACTCGAGTTGTATTGCTCACAGCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144578.2-772s1c1
Sequence:CCGGGACTCTATCCTACTCCCAGTACTCGAGTACTGGGAGTAGGATAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-235s1c1
Sequence:CCGGCCAACCCTTGGAATAATCCGACTCGAGTCGGATTATTCCAAGGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144578.2-2170s1c1
Sequence:CCGGGCAGTGTGACTGTGTTGCTTACTCGAGTAAGCAACACAGTCACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-240s1c1
Sequence:CCGGCCTTGGAATAATCCGAGTGCTCTCGAGAGCACTCGGATTATTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-562s1c1
Sequence:CCGGGATCCATGTCTTCTGGACCTTCTCGAGAAGGTCCAGAAGACATGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144578.2-1207s1c1
Sequence:CCGGGCAACTTCATTGGCAAATTATCTCGAGATAATTTGCCAATGAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144578.2-467s1c1
Sequence:CCGGGCCATATCCTACACCAAATATCTCGAGATATTTGGTGTAGGATATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144578.2-790s1c1
Sequence:CCGGGTAATCCTTTCCAAGTGCCTTCTCGAGAAGGCACTTGGAAAGGATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144578.3-1314s21c1
Sequence:CCGGTCGAGAATAACCCATCATAATCTCGAGATTATGATGGGTTATTCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_144578.3-506s21c1
Sequence:CCGGGCCATATCCTACACCAAATATCTCGAGATATTTGGTGTAGGATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_144578.3-220s21c1
Sequence:CCGGCCTCTGCTGTGAGCAATACAACTCGAGTTGTATTGCTCACAGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_144578.3-811s21c1
Sequence:CCGGGACTCTATCCTACTCCCAGTACTCGAGTACTGGGAGTAGGATAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144578
VALIDATED
MAPK1IP1L MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 1 interacting protein 1-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-181s1c1
Sequence:CCGGCCTCTGCTGTGAGCAATACAACTCGAGTTGTATTGCTCACAGCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144578.2-772s1c1
Sequence:CCGGGACTCTATCCTACTCCCAGTACTCGAGTACTGGGAGTAGGATAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-235s1c1
Sequence:CCGGCCAACCCTTGGAATAATCCGACTCGAGTCGGATTATTCCAAGGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144578.2-2170s1c1
Sequence:CCGGGCAGTGTGACTGTGTTGCTTACTCGAGTAAGCAACACAGTCACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-240s1c1
Sequence:CCGGCCTTGGAATAATCCGAGTGCTCTCGAGAGCACTCGGATTATTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-562s1c1
Sequence:CCGGGATCCATGTCTTCTGGACCTTCTCGAGAAGGTCCAGAAGACATGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144578.2-1207s1c1
Sequence:CCGGGCAACTTCATTGGCAAATTATCTCGAGATAATTTGCCAATGAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144578.2-467s1c1
Sequence:CCGGGCCATATCCTACACCAAATATCTCGAGATATTTGGTGTAGGATATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144578.2-790s1c1
Sequence:CCGGGTAATCCTTTCCAAGTGCCTTCTCGAGAAGGCACTTGGAAAGGATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144578.3-1314s21c1
Sequence:CCGGTCGAGAATAACCCATCATAATCTCGAGATTATGATGGGTTATTCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_144578.3-506s21c1
Sequence:CCGGGCCATATCCTACACCAAATATCTCGAGATATTTGGTGTAGGATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_144578.3-220s21c1
Sequence:CCGGCCTCTGCTGTGAGCAATACAACTCGAGTTGTATTGCTCACAGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_144578.3-811s21c1
Sequence:CCGGGACTCTATCCTACTCCCAGTACTCGAGTACTGGGAGTAGGATAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144578
VALIDATED
MAPK1IP1L MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 1 interacting protein 1-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-181s1c1
Sequence:CCGGCCTCTGCTGTGAGCAATACAACTCGAGTTGTATTGCTCACAGCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144578.2-772s1c1
Sequence:CCGGGACTCTATCCTACTCCCAGTACTCGAGTACTGGGAGTAGGATAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-235s1c1
Sequence:CCGGCCAACCCTTGGAATAATCCGACTCGAGTCGGATTATTCCAAGGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144578.2-2170s1c1
Sequence:CCGGGCAGTGTGACTGTGTTGCTTACTCGAGTAAGCAACACAGTCACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-240s1c1
Sequence:CCGGCCTTGGAATAATCCGAGTGCTCTCGAGAGCACTCGGATTATTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144578.2-562s1c1
Sequence:CCGGGATCCATGTCTTCTGGACCTTCTCGAGAAGGTCCAGAAGACATGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144578.2-1207s1c1
Sequence:CCGGGCAACTTCATTGGCAAATTATCTCGAGATAATTTGCCAATGAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144578.2-467s1c1
Sequence:CCGGGCCATATCCTACACCAAATATCTCGAGATATTTGGTGTAGGATATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144578.2-790s1c1
Sequence:CCGGGTAATCCTTTCCAAGTGCCTTCTCGAGAAGGCACTTGGAAAGGATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144578.3-1314s21c1
Sequence:CCGGTCGAGAATAACCCATCATAATCTCGAGATTATGATGGGTTATTCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_144578.3-506s21c1
Sequence:CCGGGCCATATCCTACACCAAATATCTCGAGATATTTGGTGTAGGATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_144578.3-220s21c1
Sequence:CCGGCCTCTGCTGTGAGCAATACAACTCGAGTTGTATTGCTCACAGCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_144578.3-811s21c1
Sequence:CCGGGACTCTATCCTACTCCCAGTACTCGAGTACTGGGAGTAGGATAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)