EMAIL THIS PAGE TO A FRIEND

MAPK3

mitogen-activated protein kinase 3

143 Gene Product Result for
Synonyms: ERK-1 ERK1 ERT2 HS44KDAP HUMKER1A P44ERK1 P44MAPK PRKM3 p44-ERK1 p44-MAPK
UniProtKB ID: P27361, A8CZ58, B0LPG3, Q8NHX1
Gene ID:
Human(5595) Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(26417) mitogen-activated protein kinase 3
Rat(50689) mitogen activated protein kinase 3
Zebrafish(399480) mitogen-activated protein kinase 3
cow(531391) mitogen-activated protein kinase 3
Horse(100066173) mitogen-activated protein kinase 3
domestic cat(101087958) mitogen-activated protein kinase 3
dog(479790) mitogen-activated protein kinase 3
naked mole-rat(101702687) mitogen-activated protein kinase 3
domestic guinea pig(100725692) mitogen-activated protein kinase 3
sheep(101123008) mitogen-activated protein kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306604 ANTI-BI-PHOSPHO-ERK1/2(T202/Y204) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2500364 Anti-ERK1/MAPK3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
M7927 Anti-MAP Kinase (ERK-1, 351-368) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat
immunoprecipitation (IP), microarray, western blot pricing
M5670 Anti-MAP Kinase (ERK-1, ERK-2) antibody produced in rabbit whole antiserum human, rat, mouse
microarray, western blot pricing
M9692 Anti-MAP Kinase, Activated (Diphosphorylated ERK-1&2) antibody, Mouse monoclonal clone MAPK-YT, purified from hybridoma cell culture yeast, Xenopus, human, rat, bovine, Caenorhabditis elegans, Drosophila, hamster, mouse
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB4300493 Anti-MAPK3 (Ab-202) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4300494 Anti-MAPK3 (Ab-204) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
GW22781 Anti-MAPK3 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1412386 ANTI-MAPK3 antibody produced in mouse clone 1E2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2701851 Anti-mapk3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701769 Anti-mapk3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701770 Anti-mapk3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA003995 Anti-MAPK3 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA005700 Anti-MAPK3 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
SAB2104574 Anti-MAPK3 antibody produced in rabbit affinity isolated antibody rat, guinea pig, bovine, rabbit, human, mouse, horse, pig, zebrafish
western blot pricing
SAB2104732 Anti-MAPK3 antibody produced in rabbit affinity isolated antibody mouse, rabbit, guinea pig, horse, human, rat
western blot pricing
SAB4502389 Anti-p44 MAP Kinase antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4502390 Anti-p44 MAP Kinase antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502393 Anti-P44 MAPK antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4502392 Anti-P44 MAPK, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
E7028 Anti-phospho-ERK1 (pThr202/pTyr204) and ERK2 (pThr185/pTyr187) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat, chicken
immunocytochemistry, western blot pricing
SAB4300194 Anti-phospho-MAPK3 (pThr202) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300195 Anti-phospho-MAPK3 (pTyr204) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504395 Anti-phospho-p44/42 MAP Kinase (pThr202) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4504396 Anti-phospho-p44/42 MAP Kinase (pTyr204) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1305560 MONOCLONAL ANTI-ERK1/2 antibody produced in mouse clone 784CT7.6.3, IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
M8159 Monoclonal Anti-MAP Kinase, Activated (Diphosphorylated ERK-1&2) antibody produced in mouse clone MAPK-YT, ascites fluid yeast, Xenopus, human, rat, bovine, Caenorhabditis elegans, Drosophila, hamster, mouse
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
F7776 Monoclonal Anti-MAP Kinase, Activated (Diphosphorylated ERK-1&2)−FITC antibody produced in mouse clone MAPK-YT, purified immunoglobulin, buffered aqueous solution yeast, Xenopus, human, rat, bovine, Caenorhabditis elegans, Drosophila, hamster, mouse
immunofluorescence pricing
M7802 Monoclonal Anti-MAP Kinase, Activated/monophosphorylated (Phosphothreonine ERK-1&2) antibody produced in mouse ~2 mg/mL, clone ERK-PT115, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, immunocytochemistry, microarray, western blot pricing
M3557 Monoclonal Anti-MAP Kinase, Monophosphorylated Threonine antibody produced in mouse ~2 mg/mL, clone ERK-YNP, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, microarray, western blot pricing
M3682 Monoclonal Anti-MAP Kinase, Monophosphorylated Tyrosine antibody produced in mouse ~2 mg/mL, clone ERK-PY193, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunocytochemistry, microarray, western blot pricing
M3807 Monoclonal Anti-MAP Kinase, Non-Phosphorylated ERK antibody produced in mouse ~2 mg/mL, clone ERK-NP2, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, immunocytochemistry, microarray, western blot pricing
WH0005595M1 Monoclonal Anti-MAPK3 antibody produced in mouse clone 3C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5300429 Monoclonal Anti-MAPK3 antibody produced in mouse clone 1E5, ascites fluid human, monkey, rat, mouse
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404247 Monoclonal Anti-MAPK3, (C-terminal) antibody produced in mouse clone 1B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0235 Rabbit anti-ERK1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, human, horse, chimpanzee, guinea pig, primate
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

Kits

Product # Description Species Add to Cart
 
PE0100 phospho-ERK 1&2 (pThr185/pTyr187) ELISA sufficient for 96 tests human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002746 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MABS827 Anti-ERK1/2 Antibody, clone 16A6.1 Detect ERK1/2 using this mouse monoclonal Anti-ERK1/2 Antibody, clone 16A6.1, Cat. No. MABS827. It is used in Immunohistochemistry (Paraffin) and Western Blotting. pricing
05-1152 Anti-Erk1/2 (p44/p42) Antibody, clone MK12 Detect Erk1/2 (p44/p42) using this Anti-Erk1/2 (p44/p42) Antibody, clone MK12 validated for use in WB, IP, IH(P) & IC. pricing
05-957-I Anti-ERK1/MAPK3 Antibody, CT Antibody, clone UP-158-22-3-10 This rabbit monoclonal Anti-ERK1/MAPK3 Antibody, CT, clone UP-158-22-3-10, Cat. No. 05-957-I detects levels of ERK1/MAPK3, and has been published and validated for use in Immunoprecipitation and Western Blotting. pricing
ABS44 Anti-MAPK 1/2 Antibody Detect MAPK 3/MAPK 1 (ERK1/ERK2) using this Anti-MAPK 1/2 Antibody validated for use in Immunocytochemistry, Immunoprecipitation, and Western Blotting. pricing
05-481 Anti-phospho-MAP Kinase1/2 Antibody Detect phospho-MAP Kinase1/2 using this Anti-phospho-MAP Kinase1/2 validated for use in WB, IP, ELISA & IC. pricing
MABS71 Anti-phospho-MAPK 1/2 (Thr203/Ty205) Antibody, clone 14B9.1 Anti-phospho-MAPK 1/2 (Thr203/Ty205) Antibody, clone 14B9.1 is a highly specific mouse monoclonal antibody & that targets MAPK/Erk1/2 & has been tested in western blotting. pricing
15-107 MAPK Pathway 1 Explorer Antibody MiniPack This Antibody pack contains Anti-phospho-Raf-1 Antibody(Ser338), Anti-phospho-MEK1 Antibody(Ser218/222)/ MEK2 (Ser222/226), Anti-phospho-Erk 1/2 Antibody (Thr202/Tyr204, Thr185/Tyr187), validated for use in IF, Flow, WB, Multiplexing pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040056 siRNAs that have been validated in the lab human pricing
NM_001109891 Rosetta Predictions human pricing
NM_002746 siRNAs that have been validated in the lab human pricing
NM_017347 Rosetta Predictions rat pricing
NM_011952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040056 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190617 validated 504
2 SASI_Hs01_00190619 predicted 628
3 SASI_Hs01_00190621 predicted 468
4 SASI_Hs01_00190622 predicted 1639
5 SASI_Hs02_00308773 predicted 478
6 SASI_Hs01_00190623 predicted 517
7 SASI_Hs01_00190624 predicted 439
8 SASI_Hs01_00190625 predicted 389
9 SASI_Hs02_00308774 predicted 474
10 SASI_Hs02_00308775 predicted 407
11 SASI_Hs01_00190618 predicted 846
12 SASI_Hs01_00190620 predicted 666
13 SASI_Hs01_00190626 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324783 predicted 507
2 SASI_Hs02_00324784 predicted 625
3 SASI_Hs02_00324785 predicted 469
4 SASI_Hs02_00324786 predicted 1398
5 SASI_Hs02_00324787 predicted 483
6 SASI_Hs02_00324788 predicted 515
7 SASI_Hs02_00324789 predicted 439
8 SASI_Hs02_00324790 predicted 396
9 SASI_Hs02_00324791 predicted 476
10 SASI_Hs02_00324792 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002746 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104113 validated 634
1 SASI_Hs01_00104111 validated 500
1 SASI_Hs01_00104112 validated 847
2 SASI_Hs01_00104115 predicted 471
3 SASI_Hs01_00104116 predicted 1534
4 SASI_Hs02_00334355 predicted 478
5 SASI_Hs01_00104117 predicted 520
6 SASI_Hs01_00104118 predicted 439
7 SASI_Hs01_00104119 predicted 390
8 SASI_Hs02_00334356 predicted 475
9 SASI_Hs02_00334357 predicted 407
10 SASI_Hs01_00104114 predicted 662
11 SASI_Hs01_00104120 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261822 predicted 366
2 SASI_Rn02_00261823 predicted 553
3 SASI_Rn02_00261824 predicted 436
4 SASI_Rn02_00261825 predicted 1630
5 SASI_Rn02_00261826 predicted 502
6 SASI_Rn02_00261827 predicted 369
7 SASI_Rn02_00261828 predicted 666
8 SASI_Rn02_00261829 predicted 1399
9 SASI_Rn02_00261830 predicted 947
10 SASI_Rn02_00261831 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164575 predicted 612
2 SASI_Mm01_00164576 predicted 962
3 SASI_Mm01_00164577 predicted 1091
4 SASI_Mm02_00321816 predicted 403
5 SASI_Mm01_00164578 predicted 492
6 SASI_Mm02_00321817 predicted 811
7 SASI_Mm01_00164580 predicted 963
8 SASI_Mm01_00164582 predicted 655
9 SASI_Mm01_00164584 predicted 1222
10 SASI_Mm02_00321818 predicted 1522
11 SASI_Mm01_00164579 predicted 1403
12 SASI_Mm01_00164581 predicted 1211
13 SASI_Mm01_00164583 predicted 1209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011952
VALIDATED
MAPK3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-545s21c1
Sequence:CCGGCAACACCACCTGCGACCTTAACTCGAGTTAAGGTCGCAGGTGGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-813s21c1
Sequence:CCGGCCATCCCAGGAGGACCTTAATCTCGAGATTAAGGTCCTCCTGGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-937s21c1
Sequence:CCGGACCTGCTGGACCGGATGTTAACTCGAGTTAACATCCGGTCCAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011952.2-1581s21c1
Sequence:CCGGTAAGTCTCAAGGGCTAGTTTCCTCGAGGAAACTAGCCCTTGAGACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-616s21c1
Sequence:CCGGCTGGCTTTCTGACGGAGTATGCTCGAGCATACTCCGTCAGAAAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011952.1-357s1c1
Sequence:CCGGGCCATGAGAGATGTTTACATTCTCGAGAATGTAAACATCTCTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011952.1-817s1c1
Sequence:CCGGAGGACCTTAATTGCATCATTACTCGAGTAATGATGCAATTAAGGTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011952.1-662s1c1
Sequence:CCGGCATGCTTAATTCCAAGGGCTACTCGAGTAGCCCTTGGAATTAAGCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011952.1-833s1c1
Sequence:CCGGCATTAACATGAAGGCCCGAAACTCGAGTTTCGGGCCTTCATGTTAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011952.1-305s1c1
Sequence:CCGGCCATGAGAATGTTATAGGCATCTCGAGATGCCTATAACATTCTCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011952
VALIDATED
MAPK3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-545s21c1
Sequence:CCGGCAACACCACCTGCGACCTTAACTCGAGTTAAGGTCGCAGGTGGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-813s21c1
Sequence:CCGGCCATCCCAGGAGGACCTTAATCTCGAGATTAAGGTCCTCCTGGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-937s21c1
Sequence:CCGGACCTGCTGGACCGGATGTTAACTCGAGTTAACATCCGGTCCAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011952.2-1581s21c1
Sequence:CCGGTAAGTCTCAAGGGCTAGTTTCCTCGAGGAAACTAGCCCTTGAGACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-616s21c1
Sequence:CCGGCTGGCTTTCTGACGGAGTATGCTCGAGCATACTCCGTCAGAAAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011952.1-357s1c1
Sequence:CCGGGCCATGAGAGATGTTTACATTCTCGAGAATGTAAACATCTCTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011952.1-817s1c1
Sequence:CCGGAGGACCTTAATTGCATCATTACTCGAGTAATGATGCAATTAAGGTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011952.1-662s1c1
Sequence:CCGGCATGCTTAATTCCAAGGGCTACTCGAGTAGCCCTTGGAATTAAGCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011952.1-833s1c1
Sequence:CCGGCATTAACATGAAGGCCCGAAACTCGAGTTTCGGGCCTTCATGTTAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011952.1-305s1c1
Sequence:CCGGCCATGAGAATGTTATAGGCATCTCGAGATGCCTATAACATTCTCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011952
VALIDATED
MAPK3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-545s21c1
Sequence:CCGGCAACACCACCTGCGACCTTAACTCGAGTTAAGGTCGCAGGTGGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-813s21c1
Sequence:CCGGCCATCCCAGGAGGACCTTAATCTCGAGATTAAGGTCCTCCTGGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-937s21c1
Sequence:CCGGACCTGCTGGACCGGATGTTAACTCGAGTTAACATCCGGTCCAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011952.2-1581s21c1
Sequence:CCGGTAAGTCTCAAGGGCTAGTTTCCTCGAGGAAACTAGCCCTTGAGACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011952.2-616s21c1
Sequence:CCGGCTGGCTTTCTGACGGAGTATGCTCGAGCATACTCCGTCAGAAAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011952.1-357s1c1
Sequence:CCGGGCCATGAGAGATGTTTACATTCTCGAGAATGTAAACATCTCTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011952.1-817s1c1
Sequence:CCGGAGGACCTTAATTGCATCATTACTCGAGTAATGATGCAATTAAGGTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011952.1-662s1c1
Sequence:CCGGCATGCTTAATTCCAAGGGCTACTCGAGTAGCCCTTGGAATTAAGCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011952.1-833s1c1
Sequence:CCGGCATTAACATGAAGGCCCGAAACTCGAGTTTCGGGCCTTCATGTTAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011952.1-305s1c1
Sequence:CCGGCCATGAGAATGTTATAGGCATCTCGAGATGCCTATAACATTCTCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002746
VALIDATED
MAPK3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-583s1c1
Sequence:CCGGCGTGCTCCACCGAGATCTAAACTCGAGTTTAGATCTCGGTGGAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-399s1c1
Sequence:CCGGTCATCGGCATCCGAGACATTCCTCGAGGAATGTCTCGGATGCCGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002746.1-876s1c1
Sequence:CCGGCCTGAATTGTATCATCAACATCTCGAGATGTTGATGATACAATTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002746.1-735s1c1
Sequence:CCGGCTATACCAAGTCCATCGACATCTCGAGATGTCGATGGACTTGGTATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002746.1-606s1c1
Sequence:CCGGCGACCTTAAGATTTGTGATTTCTCGAGAAATCACAAATCTTAAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002746.1-480s1c1
Sequence:CCGGGCAGCTGAGCAATGACCATATCTCGAGATATGGTCATTGCTCAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199827    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002746.2-1375s1c1
Sequence:CCGGGCCACCTCTCTCCTTTGCTGACTCGAGTCAGCAAAGGAGAGAGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-919s1c1
Sequence:CCGGCAACATGAAGGCCCGAAACTACTCGAGTAGTTTCGGGCCTTCATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-1245s1c1
Sequence:CCGGGACAGACATCTCTGCACCCTGCTCGAGCAGGGTGCAGAGATGTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002746
VALIDATED
MAPK3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-583s1c1
Sequence:CCGGCGTGCTCCACCGAGATCTAAACTCGAGTTTAGATCTCGGTGGAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-399s1c1
Sequence:CCGGTCATCGGCATCCGAGACATTCCTCGAGGAATGTCTCGGATGCCGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002746.1-876s1c1
Sequence:CCGGCCTGAATTGTATCATCAACATCTCGAGATGTTGATGATACAATTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002746.1-735s1c1
Sequence:CCGGCTATACCAAGTCCATCGACATCTCGAGATGTCGATGGACTTGGTATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002746.1-606s1c1
Sequence:CCGGCGACCTTAAGATTTGTGATTTCTCGAGAAATCACAAATCTTAAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002746.1-480s1c1
Sequence:CCGGGCAGCTGAGCAATGACCATATCTCGAGATATGGTCATTGCTCAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199827    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002746.2-1375s1c1
Sequence:CCGGGCCACCTCTCTCCTTTGCTGACTCGAGTCAGCAAAGGAGAGAGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-919s1c1
Sequence:CCGGCAACATGAAGGCCCGAAACTACTCGAGTAGTTTCGGGCCTTCATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-1245s1c1
Sequence:CCGGGACAGACATCTCTGCACCCTGCTCGAGCAGGGTGCAGAGATGTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002746
VALIDATED
MAPK3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-583s1c1
Sequence:CCGGCGTGCTCCACCGAGATCTAAACTCGAGTTTAGATCTCGGTGGAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-399s1c1
Sequence:CCGGTCATCGGCATCCGAGACATTCCTCGAGGAATGTCTCGGATGCCGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002746.1-876s1c1
Sequence:CCGGCCTGAATTGTATCATCAACATCTCGAGATGTTGATGATACAATTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002746.1-735s1c1
Sequence:CCGGCTATACCAAGTCCATCGACATCTCGAGATGTCGATGGACTTGGTATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002746.1-606s1c1
Sequence:CCGGCGACCTTAAGATTTGTGATTTCTCGAGAAATCACAAATCTTAAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002746.1-480s1c1
Sequence:CCGGGCAGCTGAGCAATGACCATATCTCGAGATATGGTCATTGCTCAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199827    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002746.2-1375s1c1
Sequence:CCGGGCCACCTCTCTCCTTTGCTGACTCGAGTCAGCAAAGGAGAGAGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-919s1c1
Sequence:CCGGCAACATGAAGGCCCGAAACTACTCGAGTAGTTTCGGGCCTTCATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002746.2-1245s1c1
Sequence:CCGGGACAGACATCTCTGCACCCTGCTCGAGCAGGGTGCAGAGATGTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)