EMAIL THIS PAGE TO A FRIEND

MAPK4

mitogen-activated protein kinase 4

142 Gene Product Result for
Synonyms: ERK-4 ERK3 Erk4 MAPK 4 PRKM4 p63MAPK
UniProtKB ID: P31152
Gene ID:
Human(5596) Summary: Mitogen-activated protein kinase 4 is a member of the mitogen-activated protein kinase family. Tyrosine kinase growth factor receptors activate mitogen-activated protein kinases which then translocate into the nucleus where it phosphorylates nuclear targets. [provided by RefSeq, Jul 2008]
Mouse(225724) mitogen-activated protein kinase 4
Rat(54268) mitogen-activated protein kinase 4
sheep(101112939) mitogen-activated protein kinase 4
domestic guinea pig(100723009) mitogen-activated protein kinase 4
naked mole-rat(101700581) mitogen-activated protein kinase 4
Domestic Rabbit(100343055) mitogen-activated protein kinase 4
Zebrafish(406782) mitogen-activated protein kinase 4
cow(529183) mitogen-activated protein kinase 4
Horse(100053916) mitogen-activated protein kinase 4
domestic cat(101092057) mitogen-activated protein kinase 4
dog(491690) mitogen-activated protein kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002747 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002747 Rosetta Predictions human pricing
XM_001053505 Rosetta Predictions rat pricing
XM_225726 Rosetta Predictions rat pricing
NM_172632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334358 predicted 1827
2 SASI_Hs01_00026007 predicted 1863
3 SASI_Hs01_00026008 predicted 1844
4 SASI_Hs01_00026009 predicted 1368
5 SASI_Hs01_00026010 predicted 1509
6 SASI_Hs01_00026011 predicted 1083
7 SASI_Hs01_00026012 predicted 2038
8 SASI_Hs01_00026014 predicted 1522
9 SASI_Hs01_00026015 predicted 1136
10 SASI_Hs01_00026016 predicted 1554
11 SASI_Hs01_00026013 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272536 predicted 924
2 SASI_Rn02_00272537 predicted 2106
3 SASI_Rn02_00272538 predicted 959
4 SASI_Rn02_00272539 predicted 1982
5 SASI_Rn02_00272540 predicted 771
6 SASI_Rn02_00272541 predicted 618
7 SASI_Rn02_00272542 predicted 1197
8 SASI_Rn02_00272543 predicted 391
9 SASI_Rn02_00272544 predicted 532
10 SASI_Rn02_00272545 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383094 predicted 445
2 SASI_Rn02_00383095 predicted 598
3 SASI_Rn02_00383096 predicted 570
4 SASI_Rn02_00383097 predicted 502
5 SASI_Rn02_00383098 predicted 405
6 SASI_Rn02_00383099 predicted 551
7 SASI_Rn02_00383100 predicted 488
8 SASI_Rn02_00383101 predicted 432
9 SASI_Rn02_00383102 predicted 612
10 SASI_Rn02_00383103 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344339 predicted 2949
2 SASI_Mm01_00057127 predicted 1809
3 SASI_Mm02_00344340 predicted 2827
4 SASI_Mm01_00057128 predicted 1508
5 SASI_Mm01_00057129 predicted 2569
6 SASI_Mm01_00057130 predicted 2863
7 SASI_Mm01_00057131 predicted 2236
8 SASI_Mm01_00057133 predicted 2549
9 SASI_Mm01_00057134 predicted 2737
10 SASI_Mm01_00057136 predicted 1488
11 SASI_Mm01_00057132 predicted 2838
12 SASI_Mm01_00057135 predicted 2690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172632
MAPK4 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172632.1-1301s1c1
Sequence:CCGGCACGCCAAGCTGTTCATGTATCTCGAGATACATGAACAGCTTGGCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172632.2-3052s21c1
Sequence:CCGGGTGACCCACTTAGTCTCAAATCTCGAGATTTGAGACTAAGTGGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172632.1-1442s1c1
Sequence:CCGGGCAAGGATCGTGGATCAACATCTCGAGATGTTGATCCACGATCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172632.1-1150s1c1
Sequence:CCGGCGACAACATTGTCAAGGTGTACTCGAGTACACCTTGACAATGTTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172632.2-1225s21c1
Sequence:CCGGAGGGCGAGCTCTTCAAGTTTACTCGAGTAAACTTGAAGAGCTCGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172632.2-1483s21c1
Sequence:CCGGATTACTCACACAAGGGTTATCCTCGAGGATAACCCTTGTGTGAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172632.2-2561s21c1
Sequence:CCGGGTTCATCTCGCGTGCCCTAAACTCGAGTTTAGGGCACGCGAGATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172632
MAPK4 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172632.1-1301s1c1
Sequence:CCGGCACGCCAAGCTGTTCATGTATCTCGAGATACATGAACAGCTTGGCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172632.2-3052s21c1
Sequence:CCGGGTGACCCACTTAGTCTCAAATCTCGAGATTTGAGACTAAGTGGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172632.1-1442s1c1
Sequence:CCGGGCAAGGATCGTGGATCAACATCTCGAGATGTTGATCCACGATCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172632.1-1150s1c1
Sequence:CCGGCGACAACATTGTCAAGGTGTACTCGAGTACACCTTGACAATGTTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172632.2-1225s21c1
Sequence:CCGGAGGGCGAGCTCTTCAAGTTTACTCGAGTAAACTTGAAGAGCTCGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172632.2-1483s21c1
Sequence:CCGGATTACTCACACAAGGGTTATCCTCGAGGATAACCCTTGTGTGAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172632.2-2561s21c1
Sequence:CCGGGTTCATCTCGCGTGCCCTAAACTCGAGTTTAGGGCACGCGAGATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172632
MAPK4 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172632.1-1301s1c1
Sequence:CCGGCACGCCAAGCTGTTCATGTATCTCGAGATACATGAACAGCTTGGCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172632.2-3052s21c1
Sequence:CCGGGTGACCCACTTAGTCTCAAATCTCGAGATTTGAGACTAAGTGGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172632.1-1442s1c1
Sequence:CCGGGCAAGGATCGTGGATCAACATCTCGAGATGTTGATCCACGATCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172632.1-1150s1c1
Sequence:CCGGCGACAACATTGTCAAGGTGTACTCGAGTACACCTTGACAATGTTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172632.2-1225s21c1
Sequence:CCGGAGGGCGAGCTCTTCAAGTTTACTCGAGTAAACTTGAAGAGCTCGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172632.2-1483s21c1
Sequence:CCGGATTACTCACACAAGGGTTATCCTCGAGGATAACCCTTGTGTGAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172632.2-2561s21c1
Sequence:CCGGGTTCATCTCGCGTGCCCTAAACTCGAGTTTAGGGCACGCGAGATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002747
MAPK4 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 4
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002747.x-3808s1c1
Sequence:CCGGCTCACACCACACGCCTTAAATCTCGAGATTTAAGGCGTGTGGTGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-1105s1c1
Sequence:CCGGACTACACCAAAGCCATCGACACTCGAGTGTCGATGGCTTTGGTGTAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-1017s1c1
Sequence:CCGGGATCAGCATTACTCCCACAAGCTCGAGCTTGTGGGAGTAATGCTGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-1331s1c1
Sequence:CCGGAGTGAACAGTGAAGCCATCGACTCGAGTCGATGGCTTCACTGTTCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-623s1c1
Sequence:CCGGGAAGGTCGCTGTGAAGAAGATCTCGAGATCTTCTTCACAGCGACCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-2008s1c1
Sequence:CCGGCATCGTGCTGATGGCCGCTAACTCGAGTTAGCGGCCATCAGCACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-2476s1c1
Sequence:CCGGGATCGCGCAGTGGGTCAAGAGCTCGAGCTCTTGACCCACTGCGCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-2685s1c1
Sequence:CCGGGCGACCTCAATGGTGCGTGCACTCGAGTGCACGCACCATTGAGGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-1724s1c1
Sequence:CCGGCTGGAGACCATCCCTGTAATCCTCGAGGATTACAGGGATGGTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002747.3-3410s21c1
Sequence:CCGGCTAGTCACCAAGCATACTTTCCTCGAGGAAAGTATGCTTGGTGACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-2660s21c1
Sequence:CCGGGAGGACCTGCCGGACAATAAACTCGAGTTTATTGTCCGGCAGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-1845s21c1
Sequence:CCGGACAGTGAAGCCATCGACTTTCCTCGAGGAAAGTCGATGGCTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-1533s21c1
Sequence:CCGGATTACTCCCACAAGGGTTATCCTCGAGGATAACCCTTGTGGGAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-1218s21c1
Sequence:CCGGACCACGACAACATCGTCAAAGCTCGAGCTTTGACGATGTTGTCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002747
MAPK4 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 4
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002747.x-3808s1c1
Sequence:CCGGCTCACACCACACGCCTTAAATCTCGAGATTTAAGGCGTGTGGTGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-1105s1c1
Sequence:CCGGACTACACCAAAGCCATCGACACTCGAGTGTCGATGGCTTTGGTGTAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-1017s1c1
Sequence:CCGGGATCAGCATTACTCCCACAAGCTCGAGCTTGTGGGAGTAATGCTGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-1331s1c1
Sequence:CCGGAGTGAACAGTGAAGCCATCGACTCGAGTCGATGGCTTCACTGTTCACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-623s1c1
Sequence:CCGGGAAGGTCGCTGTGAAGAAGATCTCGAGATCTTCTTCACAGCGACCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-2008s1c1
Sequence:CCGGCATCGTGCTGATGGCCGCTAACTCGAGTTAGCGGCCATCAGCACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-2476s1c1
Sequence:CCGGGATCGCGCAGTGGGTCAAGAGCTCGAGCTCTTGACCCACTGCGCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-2685s1c1
Sequence:CCGGGCGACCTCAATGGTGCGTGCACTCGAGTGCACGCACCATTGAGGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-1724s1c1
Sequence:CCGGCTGGAGACCATCCCTGTAATCCTCGAGGATTACAGGGATGGTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002747.3-3410s21c1
Sequence:CCGGCTAGTCACCAAGCATACTTTCCTCGAGGAAAGTATGCTTGGTGACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-2660s21c1
Sequence:CCGGGAGGACCTGCCGGACAATAAACTCGAGTTTATTGTCCGGCAGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-1845s21c1
Sequence:CCGGACAGTGAAGCCATCGACTTTCCTCGAGGAAAGTCGATGGCTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-1533s21c1
Sequence:CCGGATTACTCCCACAAGGGTTATCCTCGAGGATAACCCTTGTGGGAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-1218s21c1
Sequence:CCGGACCACGACAACATCGTCAAAGCTCGAGCTTTGACGATGTTGTCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002747
MAPK4 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 4
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002747.x-3808s1c1
Sequence:CCGGCTCACACCACACGCCTTAAATCTCGAGATTTAAGGCGTGTGGTGTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-1105s1c1
Sequence:CCGGACTACACCAAAGCCATCGACACTCGAGTGTCGATGGCTTTGGTGTAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-1017s1c1
Sequence:CCGGGATCAGCATTACTCCCACAAGCTCGAGCTTGTGGGAGTAATGCTGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-1331s1c1
Sequence:CCGGAGTGAACAGTGAAGCCATCGACTCGAGTCGATGGCTTCACTGTTCACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.x-623s1c1
Sequence:CCGGGAAGGTCGCTGTGAAGAAGATCTCGAGATCTTCTTCACAGCGACCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-2008s1c1
Sequence:CCGGCATCGTGCTGATGGCCGCTAACTCGAGTTAGCGGCCATCAGCACGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-2476s1c1
Sequence:CCGGGATCGCGCAGTGGGTCAAGAGCTCGAGCTCTTGACCCACTGCGCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-2685s1c1
Sequence:CCGGGCGACCTCAATGGTGCGTGCACTCGAGTGCACGCACCATTGAGGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002747.3-1724s1c1
Sequence:CCGGCTGGAGACCATCCCTGTAATCCTCGAGGATTACAGGGATGGTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002747.3-3410s21c1
Sequence:CCGGCTAGTCACCAAGCATACTTTCCTCGAGGAAAGTATGCTTGGTGACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-2660s21c1
Sequence:CCGGGAGGACCTGCCGGACAATAAACTCGAGTTTATTGTCCGGCAGGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-1845s21c1
Sequence:CCGGACAGTGAAGCCATCGACTTTCCTCGAGGAAAGTCGATGGCTTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-1533s21c1
Sequence:CCGGATTACTCCCACAAGGGTTATCCTCGAGGATAACCCTTGTGGGAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002747.3-1218s21c1
Sequence:CCGGACCACGACAACATCGTCAAAGCTCGAGCTTTGACGATGTTGTCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)