EMAIL THIS PAGE TO A FRIEND

MAPK6

mitogen-activated protein kinase 6

173 Gene Product Result for
Synonyms: ERK3 HsT17250 PRKM6 p97MAPK
UniProtKB ID: Q16659, Q68DH4, Q8IYN8
Gene ID:
Human(5597) Summary: The protein encoded by this gene is a member of the Ser/Thr protein kinase family, and is most closely related to mitogen-activated protein kinases (MAP kinases). MAP kinases also known as extracellular signal-regulated kinases (ERKs), are activated through protein phosphorylation cascades and act as integration points for multiple biochemical signals. This kinase is localized in the nucleus, and has been reported to be activated in fibroblasts upon treatment with serum or phorbol esters. [provided by RefSeq, Jul 2008]
Mouse(50772) mitogen-activated protein kinase 6
Rat(58840) mitogen-activated protein kinase 6
Zebrafish(565830) mitogen-activated protein kinase 6
chicken(415419) mitogen-activated protein kinase 6
dog(478311) mitogen-activated protein kinase 6
cow(538094) mitogen-activated protein kinase 6
Horse(100055006) mitogen-activated protein kinase 6
domestic cat(100169964) mitogen-activated protein kinase 6
domestic cat(101093275) mitogen-activated protein kinase 6
Domestic Rabbit(100356648) mitogen-activated protein kinase 6
naked mole-rat(101700449) mitogen-activated protein kinase 6
domestic guinea pig(100722907) mitogen-activated protein kinase 6
sheep(101103324) mitogen-activated protein kinase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M2572 Anti-MAPK6 (621-635) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW22782 Anti-MAPK6 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
HPA030262 Anti-MAPK6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1302456 ANTI-MOUSE MAPK6 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4502395 Anti-P97 MAPK antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4502396 Anti-P97 MAPK antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB4504175 Anti-phospho-ERK3 (pSer189) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
WH0005597M1 Monoclonal Anti-MAPK6 antibody produced in mouse clone 1G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404248 Monoclonal Anti-MAPK6, (C-terminal) antibody produced in mouse clone 4C11, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002748 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002748 siRNAs that have been validated in the lab human pricing
NM_031622 Rosetta Predictions rat pricing
NM_015806 Rosetta Predictions mouse pricing
NM_027418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002748 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080066 validated 1573
1 SASI_Hs01_00080065 validated 2825
1 SASI_Hs01_00080064 validated 2888
2 SASI_Hs02_00334359 predicted 1796
3 SASI_Hs02_00334360 predicted 1491
4 SASI_Hs01_00080067 predicted 1275
5 SASI_Hs01_00080068 predicted 1695
6 SASI_Hs01_00080069 predicted 2152
7 SASI_Hs01_00080070 predicted 2062
8 SASI_Hs01_00080071 predicted 1842
9 SASI_Hs01_00080072 predicted 1822
10 SASI_Hs01_00080073 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055347 predicted 1798
2 SASI_Rn01_00055348 predicted 780
3 SASI_Rn01_00055350 predicted 1441
4 SASI_Rn02_00264928 predicted 1313
5 SASI_Rn01_00055351 predicted 1284
6 SASI_Rn01_00055352 predicted 1550
7 SASI_Rn02_00264929 predicted 2174
8 SASI_Rn01_00055353 predicted 2220
9 SASI_Rn01_00055354 predicted 2073
10 SASI_Rn02_00264930 predicted 1455
11 SASI_Rn01_00055346 predicted 1058
12 SASI_Rn01_00055349 predicted 1876
13 SASI_Rn01_00055355 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153079 predicted 786
2 SASI_Mm01_00153080 predicted 1214
3 SASI_Mm01_00153081 predicted 1812
4 SASI_Mm01_00153082 predicted 1078
5 SASI_Mm01_00153083 predicted 1297
6 SASI_Mm01_00153084 predicted 1453
7 SASI_Mm01_00153085 predicted 818
8 SASI_Mm02_00323190 predicted 1329
9 SASI_Mm01_00153086 predicted 2075
10 SASI_Mm01_00153087 predicted 1554
11 SASI_Mm01_00153088 predicted 2185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132820 predicted 790
2 SASI_Mm01_00132821 predicted 1225
3 SASI_Mm01_00132822 predicted 1812
4 SASI_Mm01_00132823 predicted 1082
5 SASI_Mm01_00132824 predicted 1295
6 SASI_Mm01_00132825 predicted 1460
7 SASI_Mm01_00132826 predicted 824
8 SASI_Mm01_00132827 predicted 1328
9 SASI_Mm01_00132828 predicted 2086
10 SASI_Mm01_00132829 predicted 1565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002748
VALIDATED
MAPK6 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 6
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-2669s21c1
Sequence:CCGGCACTAGTTACTTGGACAAGTTCTCGAGAACTTGTCCAAGTAACTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-2631s1c1
Sequence:CCGGCACTAGTTACTTGGACAAGTTCTCGAGAACTTGTCCAAGTAACTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-1693s1c1
Sequence:CCGGCATCCTTACATGAGCATATATCTCGAGATATATGCTCATGTAAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-806s1c1
Sequence:CCGGGTTCTAGGTATATGGACTTAACTCGAGTTAAGTCCATATACCTAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.2-3707s1c1
Sequence:CCGGGCATCTATAATGTCAGCTTATCTCGAGATAAGCTGACATTATAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-836s21c1
Sequence:CCGGTGATCTGGGTTCTAGGTATATCTCGAGATATACCTAGAACCCAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-1732s21c1
Sequence:CCGGATCCTTACATGAGCATATATTCTCGAGAATATATGCTCATGTAAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-1602s21c1
Sequence:CCGGGACATGACTGAGCCACACAAACTCGAGTTTGTGTGGCTCAGTCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002748.2-4026s1c1
Sequence:CCGGCCCAAGGCAAGCATGAATAAACTCGAGTTTATTCATGCTTGCCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.x-1564s1c1
Sequence:CCGGGACATGACTGAGCCACACAAACTCGAGTTTGTGTGGCTCAGTCATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.x-798s1c1
Sequence:CCGGTGATCTGGGTTCTAGGTATATCTCGAGATATACCTAGAACCCAGATCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.x-3734s1c1
Sequence:CCGGGCTGTCCACGTACTTAATTTACTCGAGTAAATTAAGTACGTGGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.x-1043s1c1
Sequence:CCGGGCTCTCTTACGGAACTGAACACTCGAGTGTTCAGTTCCGTAAGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.x-1603s1c1
Sequence:CCGGCCAGGAATTAGTCGAGAAGCACTCGAGTGCTTCTCGACTAATTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002748.3-3522s21c1
Sequence:CCGGCCAGCGTTTATTGTAGTAAACCTCGAGGTTTACTACAATAAACGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-3484s1c1
Sequence:CCGGCCAGCGTTTATTGTAGTAAACCTCGAGGTTTACTACAATAAACGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002748
VALIDATED
MAPK6 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 6
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-2669s21c1
Sequence:CCGGCACTAGTTACTTGGACAAGTTCTCGAGAACTTGTCCAAGTAACTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-2631s1c1
Sequence:CCGGCACTAGTTACTTGGACAAGTTCTCGAGAACTTGTCCAAGTAACTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-1693s1c1
Sequence:CCGGCATCCTTACATGAGCATATATCTCGAGATATATGCTCATGTAAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-806s1c1
Sequence:CCGGGTTCTAGGTATATGGACTTAACTCGAGTTAAGTCCATATACCTAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.2-3707s1c1
Sequence:CCGGGCATCTATAATGTCAGCTTATCTCGAGATAAGCTGACATTATAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-836s21c1
Sequence:CCGGTGATCTGGGTTCTAGGTATATCTCGAGATATACCTAGAACCCAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-1732s21c1
Sequence:CCGGATCCTTACATGAGCATATATTCTCGAGAATATATGCTCATGTAAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-1602s21c1
Sequence:CCGGGACATGACTGAGCCACACAAACTCGAGTTTGTGTGGCTCAGTCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002748.2-4026s1c1
Sequence:CCGGCCCAAGGCAAGCATGAATAAACTCGAGTTTATTCATGCTTGCCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.x-1564s1c1
Sequence:CCGGGACATGACTGAGCCACACAAACTCGAGTTTGTGTGGCTCAGTCATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.x-798s1c1
Sequence:CCGGTGATCTGGGTTCTAGGTATATCTCGAGATATACCTAGAACCCAGATCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.x-3734s1c1
Sequence:CCGGGCTGTCCACGTACTTAATTTACTCGAGTAAATTAAGTACGTGGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.x-1043s1c1
Sequence:CCGGGCTCTCTTACGGAACTGAACACTCGAGTGTTCAGTTCCGTAAGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.x-1603s1c1
Sequence:CCGGCCAGGAATTAGTCGAGAAGCACTCGAGTGCTTCTCGACTAATTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002748.3-3522s21c1
Sequence:CCGGCCAGCGTTTATTGTAGTAAACCTCGAGGTTTACTACAATAAACGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-3484s1c1
Sequence:CCGGCCAGCGTTTATTGTAGTAAACCTCGAGGTTTACTACAATAAACGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002748
VALIDATED
MAPK6 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 6
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-2669s21c1
Sequence:CCGGCACTAGTTACTTGGACAAGTTCTCGAGAACTTGTCCAAGTAACTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-2631s1c1
Sequence:CCGGCACTAGTTACTTGGACAAGTTCTCGAGAACTTGTCCAAGTAACTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-1693s1c1
Sequence:CCGGCATCCTTACATGAGCATATATCTCGAGATATATGCTCATGTAAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-806s1c1
Sequence:CCGGGTTCTAGGTATATGGACTTAACTCGAGTTAAGTCCATATACCTAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.2-3707s1c1
Sequence:CCGGGCATCTATAATGTCAGCTTATCTCGAGATAAGCTGACATTATAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-836s21c1
Sequence:CCGGTGATCTGGGTTCTAGGTATATCTCGAGATATACCTAGAACCCAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-1732s21c1
Sequence:CCGGATCCTTACATGAGCATATATTCTCGAGAATATATGCTCATGTAAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002748.3-1602s21c1
Sequence:CCGGGACATGACTGAGCCACACAAACTCGAGTTTGTGTGGCTCAGTCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002748.2-4026s1c1
Sequence:CCGGCCCAAGGCAAGCATGAATAAACTCGAGTTTATTCATGCTTGCCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.x-1564s1c1
Sequence:CCGGGACATGACTGAGCCACACAAACTCGAGTTTGTGTGGCTCAGTCATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.x-798s1c1
Sequence:CCGGTGATCTGGGTTCTAGGTATATCTCGAGATATACCTAGAACCCAGATCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.x-3734s1c1
Sequence:CCGGGCTGTCCACGTACTTAATTTACTCGAGTAAATTAAGTACGTGGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002748.x-1043s1c1
Sequence:CCGGGCTCTCTTACGGAACTGAACACTCGAGTGTTCAGTTCCGTAAGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.x-1603s1c1
Sequence:CCGGCCAGGAATTAGTCGAGAAGCACTCGAGTGCTTCTCGACTAATTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002748.3-3522s21c1
Sequence:CCGGCCAGCGTTTATTGTAGTAAACCTCGAGGTTTACTACAATAAACGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002748.2-3484s1c1
Sequence:CCGGCCAGCGTTTATTGTAGTAAACCTCGAGGTTTACTACAATAAACGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015806
MAPK6 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000023199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-1056s1c1
Sequence:CCGGGCGTGATTCCAGTTTACATTACTCGAGTAATGTAAACTGGAATCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-1210s1c1
Sequence:CCGGCCATCCTTACATGAGCATCTACTCGAGTAGATGCTCATGTAAGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-1490s1c1
Sequence:CCGGCGAGAGAAGTATCTAGAGGATCTCGAGATCCTCTAGATACTTCTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-2137s1c1
Sequence:CCGGGAACACCTACACCAGCTATTTCTCGAGAAATAGCTGGTGTAGGTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015806
MAPK6 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000023199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-1056s1c1
Sequence:CCGGGCGTGATTCCAGTTTACATTACTCGAGTAATGTAAACTGGAATCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-1210s1c1
Sequence:CCGGCCATCCTTACATGAGCATCTACTCGAGTAGATGCTCATGTAAGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-1490s1c1
Sequence:CCGGCGAGAGAAGTATCTAGAGGATCTCGAGATCCTCTAGATACTTCTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-2137s1c1
Sequence:CCGGGAACACCTACACCAGCTATTTCTCGAGAAATAGCTGGTGTAGGTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015806
MAPK6 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000023199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-1056s1c1
Sequence:CCGGGCGTGATTCCAGTTTACATTACTCGAGTAATGTAAACTGGAATCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-1210s1c1
Sequence:CCGGCCATCCTTACATGAGCATCTACTCGAGTAGATGCTCATGTAAGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-1490s1c1
Sequence:CCGGCGAGAGAAGTATCTAGAGGATCTCGAGATCCTCTAGATACTTCTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015806.2-2137s1c1
Sequence:CCGGGAACACCTACACCAGCTATTTCTCGAGAAATAGCTGGTGTAGGTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)