EMAIL THIS PAGE TO A FRIEND

MAPK7

mitogen-activated protein kinase 7

140 Gene Product Result for
Synonyms: BMK1 ERK4 ERK5 PRKM7
Gene ID:
Human(5598) Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the downstream signaling processes of various receptor molecules including receptor type kinases, and G protein-coupled receptors. In response to extracelluar signals, this kinase translocates to cell nucleus, where it regulates gene expression by phosphorylating, and activating different transcription factors. Four alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(23939) mitogen-activated protein kinase 7
Rat(114509) mitogen-activated protein kinase 7
Zebrafish(541323) mitogen-activated protein kinase 7
cow(537703) mitogen-activated protein kinase 7
domestic cat(101097357) mitogen-activated protein kinase 7
dog(489532) mitogen-activated protein kinase 7
sheep(101110073) mitogen-activated protein kinase 7
domestic guinea pig(100728396) mitogen-activated protein kinase 7
naked mole-rat(101726391) mitogen-activated protein kinase 7
Domestic Rabbit(100338535) mitogen-activated protein kinase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139032 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139034 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002749 Rosetta Predictions human pricing
NM_139032 Rosetta Predictions human pricing
NM_139033 Rosetta Predictions human pricing
NM_139034 Rosetta Predictions human pricing
XM_340813 Rosetta Predictions rat pricing
NM_011841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226859 predicted 838
2 SASI_Hs01_00226860 predicted 1277
3 SASI_Hs01_00226861 predicted 1180
4 SASI_Hs01_00226862 predicted 1544
5 SASI_Hs02_00334361 predicted 2363
6 SASI_Hs01_00226863 predicted 2382
7 SASI_Hs01_00226864 predicted 1294
8 SASI_Hs01_00226865 predicted 1559
9 SASI_Hs02_00334362 predicted 1476
10 SASI_Hs01_00226866 predicted 2356
11 SASI_Hs01_00226867 predicted 952
12 SASI_Hs01_00226868 predicted 2502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074973 predicted 648
2 SASI_Hs01_00074974 predicted 1085
3 SASI_Hs01_00074975 predicted 987
4 SASI_Hs01_00074976 predicted 1351
5 SASI_Hs02_00364085 predicted 2172
6 SASI_Hs01_00074977 predicted 2192
7 SASI_Hs01_00074978 predicted 1100
8 SASI_Hs01_00074979 predicted 1367
9 SASI_Hs02_00364086 predicted 1289
10 SASI_Hs01_00074980 predicted 2157
11 SASI_Hs01_00074981 predicted 762
12 SASI_Hs01_00074982 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173866 predicted 1053
2 SASI_Hs01_00173867 predicted 1490
3 SASI_Hs01_00173868 predicted 1397
4 SASI_Hs01_00173869 predicted 1761
5 SASI_Hs02_00364087 predicted 2577
6 SASI_Hs01_00173870 predicted 2588
7 SASI_Hs01_00173871 predicted 1506
8 SASI_Hs01_00173872 predicted 1771
9 SASI_Hs02_00364088 predicted 1693
10 SASI_Hs01_00173873 predicted 2568
11 SASI_Hs01_00173874 predicted 1164
12 SASI_Hs01_00173875 predicted 2715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040547 predicted 750
2 SASI_Hs01_00040548 predicted 1186
3 SASI_Hs01_00040549 predicted 1096
4 SASI_Hs01_00040550 predicted 1454
5 SASI_Hs02_00364089 predicted 2275
6 SASI_Hs01_00040551 predicted 2292
7 SASI_Hs01_00040552 predicted 1205
8 SASI_Hs01_00040553 predicted 1468
9 SASI_Hs02_00364090 predicted 1389
10 SASI_Hs01_00040554 predicted 2267
11 SASI_Hs01_00040555 predicted 867
12 SASI_Hs01_00040556 predicted 2413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142361 predicted 1592
2 SASI_Rn01_00142362 predicted 2541
3 SASI_Rn01_00142363 predicted 1353
4 SASI_Rn01_00142364 predicted 1338
5 SASI_Rn01_00142365 predicted 2411
6 SASI_Rn01_00142366 predicted 2388
7 SASI_Rn01_00142367 predicted 1450
8 SASI_Rn01_00142368 predicted 2725
9 SASI_Rn01_00142369 predicted 2440
10 SASI_Rn01_00142370 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189839 predicted 1011
2 SASI_Mm01_00189840 predicted 766
3 SASI_Mm02_00321571 predicted 578
4 SASI_Mm01_00189842 predicted 2422
5 SASI_Mm01_00189843 predicted 449
6 SASI_Mm01_00189844 predicted 2539
7 SASI_Mm01_00189846 predicted 585
8 SASI_Mm01_00189847 predicted 2027
9 SASI_Mm01_00189848 predicted 691
10 SASI_Mm02_00321572 predicted 1347
11 SASI_Mm01_00189841 predicted 611
12 SASI_Mm01_00189845 predicted 1403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011841
VALIDATED
MAPK7 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-1087s21c1
Sequence:CCGGGAAAGGGTGCGAGCCTATATCCTCGAGGATATAGGCTCGCACCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-457s1c1
Sequence:CCGGGCCATCAAGAAGATACCTAATCTCGAGATTAGGTATCTTCTTGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-1621s1c1
Sequence:CCGGGCCATCTCCGACAATACCAAACTCGAGTTTGGTATTGTCGGAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-753s1c1
Sequence:CCGGCCGTGATCTTAAACCCTCTAACTCGAGTTAGAGGGTTTAAGATCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-546s1c1
Sequence:CCGGCGACAATATCATCGCCATCAACTCGAGTTGATGGCGATGATATTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011841.1-1360s1c1
Sequence:CCGGGCTGAGATTGAGGACTTCCATCTCGAGATGGAAGTCCTCAATCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-911s21c1
Sequence:CCGGTGCTTTCCCTGCACGAGTATACTCGAGTATACTCGTGCAGGGAAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-1616s21c1
Sequence:CCGGAGGGTGCCATCTCCGACAATACTCGAGTATTGTCGGAGATGGCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-1326s21c1
Sequence:CCGGCCTTACCAGGGAGCGCATTAACTCGAGTTAATGCGCTCCCTGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-2760s21c1
Sequence:CCGGAGACCCACCTTTCAGCCTTAACTCGAGTTAAGGCTGAAAGGTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011841
VALIDATED
MAPK7 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-1087s21c1
Sequence:CCGGGAAAGGGTGCGAGCCTATATCCTCGAGGATATAGGCTCGCACCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-457s1c1
Sequence:CCGGGCCATCAAGAAGATACCTAATCTCGAGATTAGGTATCTTCTTGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-1621s1c1
Sequence:CCGGGCCATCTCCGACAATACCAAACTCGAGTTTGGTATTGTCGGAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-753s1c1
Sequence:CCGGCCGTGATCTTAAACCCTCTAACTCGAGTTAGAGGGTTTAAGATCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-546s1c1
Sequence:CCGGCGACAATATCATCGCCATCAACTCGAGTTGATGGCGATGATATTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011841.1-1360s1c1
Sequence:CCGGGCTGAGATTGAGGACTTCCATCTCGAGATGGAAGTCCTCAATCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-911s21c1
Sequence:CCGGTGCTTTCCCTGCACGAGTATACTCGAGTATACTCGTGCAGGGAAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-1616s21c1
Sequence:CCGGAGGGTGCCATCTCCGACAATACTCGAGTATTGTCGGAGATGGCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-1326s21c1
Sequence:CCGGCCTTACCAGGGAGCGCATTAACTCGAGTTAATGCGCTCCCTGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-2760s21c1
Sequence:CCGGAGACCCACCTTTCAGCCTTAACTCGAGTTAAGGCTGAAAGGTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011841
VALIDATED
MAPK7 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-1087s21c1
Sequence:CCGGGAAAGGGTGCGAGCCTATATCCTCGAGGATATAGGCTCGCACCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-457s1c1
Sequence:CCGGGCCATCAAGAAGATACCTAATCTCGAGATTAGGTATCTTCTTGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-1621s1c1
Sequence:CCGGGCCATCTCCGACAATACCAAACTCGAGTTTGGTATTGTCGGAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-753s1c1
Sequence:CCGGCCGTGATCTTAAACCCTCTAACTCGAGTTAGAGGGTTTAAGATCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011841.1-546s1c1
Sequence:CCGGCGACAATATCATCGCCATCAACTCGAGTTGATGGCGATGATATTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011841.1-1360s1c1
Sequence:CCGGGCTGAGATTGAGGACTTCCATCTCGAGATGGAAGTCCTCAATCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-911s21c1
Sequence:CCGGTGCTTTCCCTGCACGAGTATACTCGAGTATACTCGTGCAGGGAAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-1616s21c1
Sequence:CCGGAGGGTGCCATCTCCGACAATACTCGAGTATTGTCGGAGATGGCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-1326s21c1
Sequence:CCGGCCTTACCAGGGAGCGCATTAACTCGAGTTAATGCGCTCCCTGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011841.1-2760s21c1
Sequence:CCGGAGACCCACCTTTCAGCCTTAACTCGAGTTAAGGCTGAAAGGTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139032
VALIDATED
MAPK7 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.1-2520s1c1
Sequence:CCGGGTTCATCTCAGACCCACCTTTCTCGAGAAAGGTGGGTCTGAGATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.x-1032s1c1
Sequence:CCGGCCGCCCTTTGACTTTGCCTTTCTCGAGAAAGGCAAAGTCAAAGGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139032.x-1746s1c1
Sequence:CCGGCCAGTCCAACCTACCAGTCCTCTCGAGAGGACTGGTAGGTTGGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.x-993s1c1
Sequence:CCGGGCCAAGTACCATGATCCTGATCTCGAGATCAGGATCATGGTACTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139032.1-650s1c1
Sequence:CCGGGCTCTCTTTGCATGAGTATACCTCGAGGTATACTCATGCAAAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.x-1392s1c1
Sequence:CCGGGCTGCCCTGCTCAAGTCTTTGCTCGAGCAAAGACTTGAGCAGGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139032.1-2308s1c1
Sequence:CCGGGCATGAACCCTGCCGATATTGCTCGAGCAATATCGGCAGGGTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139032
VALIDATED
MAPK7 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.1-2520s1c1
Sequence:CCGGGTTCATCTCAGACCCACCTTTCTCGAGAAAGGTGGGTCTGAGATGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.x-1032s1c1
Sequence:CCGGCCGCCCTTTGACTTTGCCTTTCTCGAGAAAGGCAAAGTCAAAGGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139032.x-1746s1c1
Sequence:CCGGCCAGTCCAACCTACCAGTCCTCTCGAGAGGACTGGTAGGTTGGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.x-993s1c1
Sequence:CCGGGCCAAGTACCATGATCCTGATCTCGAGATCAGGATCATGGTACTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139032.1-650s1c1
Sequence:CCGGGCTCTCTTTGCATGAGTATACCTCGAGGTATACTCATGCAAAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.x-1392s1c1
Sequence:CCGGGCTGCCCTGCTCAAGTCTTTGCTCGAGCAAAGACTTGAGCAGGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139032.1-2308s1c1
Sequence:CCGGGCATGAACCCTGCCGATATTGCTCGAGCAATATCGGCAGGGTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139032
VALIDATED
MAPK7 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.1-2520s1c1
Sequence:CCGGGTTCATCTCAGACCCACCTTTCTCGAGAAAGGTGGGTCTGAGATGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.x-1032s1c1
Sequence:CCGGCCGCCCTTTGACTTTGCCTTTCTCGAGAAAGGCAAAGTCAAAGGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139032.x-1746s1c1
Sequence:CCGGCCAGTCCAACCTACCAGTCCTCTCGAGAGGACTGGTAGGTTGGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.x-993s1c1
Sequence:CCGGGCCAAGTACCATGATCCTGATCTCGAGATCAGGATCATGGTACTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139032.1-650s1c1
Sequence:CCGGGCTCTCTTTGCATGAGTATACCTCGAGGTATACTCATGCAAAGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_139032.x-1392s1c1
Sequence:CCGGGCTGCCCTGCTCAAGTCTTTGCTCGAGCAAAGACTTGAGCAGGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139032.1-2308s1c1
Sequence:CCGGGCATGAACCCTGCCGATATTGCTCGAGCAATATCGGCAGGGTTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139034
VALIDATED
MAPK7 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 7
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000010617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139034.x-1297s1c1
Sequence:CCGGCCAGATGTTGAAATGCCCAGTCTCGAGACTGGGCATTTCAACATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_139034.x-186s1c1
Sequence:CCGGCTTCGATGTGACCTTTGACGTCTCGAGACGTCAAAGGTCACATCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_139034.x-1470s1c1
Sequence:CCGGAGACAATACTAAGGCTGCCCTCTCGAGAGGGCAGCCTTAGTATTGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_139034.x-312s1c1
Sequence:CCGGCCCTAATGCTTTCGATGTGGTCTCGAGACCACATCGAAAGCATTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139034
VALIDATED
MAPK7 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 7
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000010617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139034.x-1297s1c1
Sequence:CCGGCCAGATGTTGAAATGCCCAGTCTCGAGACTGGGCATTTCAACATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_139034.x-186s1c1
Sequence:CCGGCTTCGATGTGACCTTTGACGTCTCGAGACGTCAAAGGTCACATCGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_139034.x-1470s1c1
Sequence:CCGGAGACAATACTAAGGCTGCCCTCTCGAGAGGGCAGCCTTAGTATTGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_139034.x-312s1c1
Sequence:CCGGCCCTAATGCTTTCGATGTGGTCTCGAGACCACATCGAAAGCATTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139034
VALIDATED
MAPK7 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 7
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000010617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139034.x-1297s1c1
Sequence:CCGGCCAGATGTTGAAATGCCCAGTCTCGAGACTGGGCATTTCAACATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_139034.x-186s1c1
Sequence:CCGGCTTCGATGTGACCTTTGACGTCTCGAGACGTCAAAGGTCACATCGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_139034.x-1470s1c1
Sequence:CCGGAGACAATACTAAGGCTGCCCTCTCGAGAGGGCAGCCTTAGTATTGTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_139034.x-312s1c1
Sequence:CCGGCCCTAATGCTTTCGATGTGGTCTCGAGACCACATCGAAAGCATTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)