EMAIL THIS PAGE TO A FRIEND

MAPK8

mitogen-activated protein kinase 8

148 Gene Product Result for
Synonyms: JNK JNK-46 JNK1 JNK1A2 JNK21B1/2 PRKM8 SAPK1 SAPK1c
Gene ID:
Human(5599) Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Five alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jun 2013]
Mouse(26419) mitogen-activated protein kinase 8
Rat(116554) mitogen-activated protein kinase 8
Domestic Rabbit(100346929) mitogen-activated protein kinase 8
naked mole-rat(101715259) mitogen-activated protein kinase 8
domestic guinea pig(100722333) mitogen-activated protein kinase 8
Goat(100861087) mitogen-activated protein kinase 8
sheep(101116201) mitogen-activated protein kinase 8
chicken(423778) mitogen-activated protein kinase 8
domestic cat(101091310) mitogen-activated protein kinase 8
cow(539941) mitogen-activated protein kinase 8
Horse(100051798) mitogen-activated protein kinase 8
dog(477746) mitogen-activated protein kinase 8
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305600 ANTI-BI-PHOSPHO-JNK1(T183/Y185) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
J4500 Anti-c-Jun N-Terminal Kinase antibody produced in rabbit whole antiserum human, mouse, rat
microarray, western blot pricing
SAB4200176 Anti-JNK antibody, Mouse monoclonal clone 1C2, purified from hybridoma cell culture mouse, rat, human
western blot pricing
SAB4502398 Anti-JNK1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB1406300 Anti-MAPK8 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
immunofluorescence, western blot pricing
J4644 Anti-phospho-JNK1/2 (pThr183/pTyr185) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, rat
western blot pricing
SAB4503929 Anti-phospho-JNK1/2/3 (pThr183+Tyr185) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300261 Anti-phospho-MAPK8/MAPK9/MAPK10 (pThr183/pTyr185) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, western blot pricing
SAB4504449 Anti-phospho-SAPK/JNK (pThr183) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504450 Anti-phospho-SAPK/JNK (pTyr185) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4502399 Anti-SAPK antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502400 Anti-SAPK antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
J4750 Monoclonal Anti-JNK, Activated (Diphosphorylated JNK) antibody produced in mouse clone JNK-PT48, ~2 mg/mL, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, microarray, western blot pricing
WH0005599M2 Monoclonal Anti-MAPK8 antibody produced in mouse clone 3B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404249 Monoclonal Anti-MAPK8 antibody produced in mouse clone 2F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A8626 Adenine ≥99% human, mouse, rat pricing
A2786 Adenine suitable for cell culture, BioReagent human, mouse, rat pricing
A5665 Adenine BioReagent, plant cell culture tested, ≥99% human, mouse, rat pricing
594687 α-Sexithiophene human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139049 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002750 siRNAs that have been validated in the lab human pricing
NM_139046 Rosetta Predictions human pricing
NM_139047 Rosetta Predictions human pricing
NM_139049 Rosetta Predictions human pricing
XM_001056513 Rosetta Predictions rat pricing
XM_341399 Rosetta Predictions rat pricing
NM_016700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002750 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010441 validated 235
1 SASI_Hs01_00010442 validated 918
1 SASI_Hs01_00010440 validated 350
2 SASI_Hs01_00010443 predicted 226
3 SASI_Hs01_00010444 predicted 372
4 SASI_Hs01_00010446 predicted 914
5 SASI_Hs01_00010447 predicted 290
6 SASI_Hs01_00010448 predicted 396
7 SASI_Hs01_00010449 predicted 366
8 SASI_Hs02_00334363 predicted 337
9 SASI_Hs02_00334364 predicted 226
10 SASI_Hs01_00010445 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214663 predicted 349
2 SASI_Hs01_00214664 predicted 233
3 SASI_Hs01_00214666 predicted 232
4 SASI_Hs01_00214667 predicted 376
5 SASI_Hs01_00214669 predicted 911
6 SASI_Hs01_00214670 predicted 298
7 SASI_Hs01_00214671 predicted 399
8 SASI_Hs01_00214672 predicted 371
9 SASI_Hs02_00364097 predicted 338
10 SASI_Hs02_00364098 predicted 223
11 SASI_Hs01_00214665 predicted 916
12 SASI_Hs01_00214668 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127957 predicted 346
2 SASI_Hs01_00127958 predicted 233
3 SASI_Hs01_00127960 predicted 230
4 SASI_Hs01_00127961 predicted 372
5 SASI_Hs01_00127963 predicted 912
6 SASI_Hs01_00127964 predicted 296
7 SASI_Hs01_00127965 predicted 393
8 SASI_Hs01_00127966 predicted 372
9 SASI_Hs02_00364099 predicted 335
10 SASI_Hs02_00364100 predicted 218
11 SASI_Hs01_00127959 predicted 917
12 SASI_Hs01_00127962 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158136 predicted 349
2 SASI_Hs01_00158137 predicted 232
3 SASI_Hs01_00158139 predicted 228
4 SASI_Hs01_00158140 predicted 374
5 SASI_Hs01_00158142 predicted 912
6 SASI_Hs01_00158143 predicted 290
7 SASI_Hs01_00158144 predicted 399
8 SASI_Hs01_00158145 predicted 370
9 SASI_Hs02_00364104 predicted 334
10 SASI_Hs02_00364105 predicted 219
11 SASI_Hs01_00158138 predicted 926
12 SASI_Hs01_00158141 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283476 predicted 319
2 SASI_Rn02_00283477 predicted 1189
3 SASI_Rn02_00283478 predicted 1001
4 SASI_Rn02_00283479 predicted 656
5 SASI_Rn02_00283480 predicted 312
6 SASI_Rn02_00283481 predicted 1153
7 SASI_Rn02_00283482 predicted 939
8 SASI_Rn02_00283483 predicted 408
9 SASI_Rn02_00283484 predicted 414
10 SASI_Rn02_00283485 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392868 predicted 324
2 SASI_Rn02_00392869 predicted 1216
3 SASI_Rn02_00392870 predicted 1028
4 SASI_Rn02_00392871 predicted 225
5 SASI_Rn02_00392872 predicted 312
6 SASI_Rn02_00392873 predicted 1179
7 SASI_Rn02_00392874 predicted 415
8 SASI_Rn02_00392875 predicted 423
9 SASI_Rn02_00392876 predicted 982
10 SASI_Rn02_00392877 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033534 predicted 1185
2 SASI_Mm01_00033535 predicted 471
3 SASI_Mm01_00033537 predicted 653
4 SASI_Mm01_00033538 predicted 224
5 SASI_Mm01_00033539 predicted 403
6 SASI_Mm01_00033540 predicted 313
7 SASI_Mm01_00033541 predicted 942
8 SASI_Mm01_00033542 predicted 625
9 SASI_Mm01_00033543 predicted 1266
10 SASI_Mm02_00323366 predicted 1046
11 SASI_Mm01_00033536 predicted 985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139049
MAPK8 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 8
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139049.1-1335s21c1
Sequence:CCGGGAGTCGGTTAGTCATTGATAGCTCGAGCTATCAATGACTAACCGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139049.1-1212s21c1
Sequence:CCGGGTGTCTTCAATGTCAACAGATCTCGAGATCTGTTGACATTGAAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139049.1-781s21c1
Sequence:CCGGCAGTAAGGACTTACGTTGAAACTCGAGTTTCAACGTAAGTCCTTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139049.1-864s21c1
Sequence:CCGGGACTCAGAACACAACAAACTTCTCGAGAAGTTTGTTGTGTTCTGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-1212s1c1
Sequence:CCGGGTGTCTTCAATGTCAACAGATCTCGAGATCTGTTGACATTGAAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-897s1c1
Sequence:CCGGGCAAGGGATTTGTTATCCAAACTCGAGTTTGGATAACAAATCCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-59s1c1
Sequence:CCGGGATTGGAGATTCTACATTCACCTCGAGGTGAATGTAGAATCTCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-805s1c1
Sequence:CCGGGACCTAAATATGCTGGATATACTCGAGTATATCCAGCATATTTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-781s1c1
Sequence:CCGGCAGTAAGGACTTACGTTGAAACTCGAGTTTCAACGTAAGTCCTTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.x-297s1c1
Sequence:CCGGCCACAGAAATCCCTAGAAGAACTCGAGTTCTTCTAGGGATTTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.x-864s1c1
Sequence:CCGGGACTCAGAACACAACAAACTTCTCGAGAAGTTTGTTGTGTTCTGAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.x-984s1c1
Sequence:CCGGGTCTGGTATGATCCTTCTGAACTCGAGTTCAGAAGGATCATACCAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139049.x-1335s1c1
Sequence:CCGGGAGTCGGTTAGTCATTGATAGCTCGAGCTATCAATGACTAACCGACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139049
MAPK8 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 8
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139049.1-1335s21c1
Sequence:CCGGGAGTCGGTTAGTCATTGATAGCTCGAGCTATCAATGACTAACCGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139049.1-1212s21c1
Sequence:CCGGGTGTCTTCAATGTCAACAGATCTCGAGATCTGTTGACATTGAAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139049.1-781s21c1
Sequence:CCGGCAGTAAGGACTTACGTTGAAACTCGAGTTTCAACGTAAGTCCTTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139049.1-864s21c1
Sequence:CCGGGACTCAGAACACAACAAACTTCTCGAGAAGTTTGTTGTGTTCTGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-1212s1c1
Sequence:CCGGGTGTCTTCAATGTCAACAGATCTCGAGATCTGTTGACATTGAAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-897s1c1
Sequence:CCGGGCAAGGGATTTGTTATCCAAACTCGAGTTTGGATAACAAATCCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-59s1c1
Sequence:CCGGGATTGGAGATTCTACATTCACCTCGAGGTGAATGTAGAATCTCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-805s1c1
Sequence:CCGGGACCTAAATATGCTGGATATACTCGAGTATATCCAGCATATTTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-781s1c1
Sequence:CCGGCAGTAAGGACTTACGTTGAAACTCGAGTTTCAACGTAAGTCCTTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.x-297s1c1
Sequence:CCGGCCACAGAAATCCCTAGAAGAACTCGAGTTCTTCTAGGGATTTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.x-864s1c1
Sequence:CCGGGACTCAGAACACAACAAACTTCTCGAGAAGTTTGTTGTGTTCTGAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.x-984s1c1
Sequence:CCGGGTCTGGTATGATCCTTCTGAACTCGAGTTCAGAAGGATCATACCAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139049.x-1335s1c1
Sequence:CCGGGAGTCGGTTAGTCATTGATAGCTCGAGCTATCAATGACTAACCGACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139049
MAPK8 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 8
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139049.1-1335s21c1
Sequence:CCGGGAGTCGGTTAGTCATTGATAGCTCGAGCTATCAATGACTAACCGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139049.1-1212s21c1
Sequence:CCGGGTGTCTTCAATGTCAACAGATCTCGAGATCTGTTGACATTGAAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139049.1-781s21c1
Sequence:CCGGCAGTAAGGACTTACGTTGAAACTCGAGTTTCAACGTAAGTCCTTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139049.1-864s21c1
Sequence:CCGGGACTCAGAACACAACAAACTTCTCGAGAAGTTTGTTGTGTTCTGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-1212s1c1
Sequence:CCGGGTGTCTTCAATGTCAACAGATCTCGAGATCTGTTGACATTGAAGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-897s1c1
Sequence:CCGGGCAAGGGATTTGTTATCCAAACTCGAGTTTGGATAACAAATCCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-59s1c1
Sequence:CCGGGATTGGAGATTCTACATTCACCTCGAGGTGAATGTAGAATCTCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-805s1c1
Sequence:CCGGGACCTAAATATGCTGGATATACTCGAGTATATCCAGCATATTTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.1-781s1c1
Sequence:CCGGCAGTAAGGACTTACGTTGAAACTCGAGTTTCAACGTAAGTCCTTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.x-297s1c1
Sequence:CCGGCCACAGAAATCCCTAGAAGAACTCGAGTTCTTCTAGGGATTTCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.x-864s1c1
Sequence:CCGGGACTCAGAACACAACAAACTTCTCGAGAAGTTTGTTGTGTTCTGAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139049.x-984s1c1
Sequence:CCGGGTCTGGTATGATCCTTCTGAACTCGAGTTCAGAAGGATCATACCAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139049.x-1335s1c1
Sequence:CCGGGAGTCGGTTAGTCATTGATAGCTCGAGCTATCAATGACTAACCGACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016700
VALIDATED
MAPK8 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 8
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1071s21c1
Sequence:CCGGGCAAGAGATTTGTTATCCAAACTCGAGTTTGGATAACAAATCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1400s21c1
Sequence:CCGGATGTCCACAGATCCGACTTTGCTCGAGCAAAGTCGGATCTGTGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1275s21c1
Sequence:CCGGGATTTGGAGGAACGAACTAAGCTCGAGCTTAGTTCGTTCCTCCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1242s21c1
Sequence:CCGGGAGTGGAAAGAACTGATATACCTCGAGGTATATCAGTTCTTTCCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-615s21c1
Sequence:CCGGCTTCACTCTGCTGGAATTATTCTCGAGAATAATTCCAGCAGAGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-1377s1c1
Sequence:CCGGCGTCTGTCAATGACATGTCTTCTCGAGAAGACATGTCATTGACAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-1146s1c1
Sequence:CCGGCCATACATCAACGTCTGGTATCTCGAGATACCAGACGTTGATGTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-650s1c1
Sequence:CCGGGCCTAGTAATATAGTAGTCAACTCGAGTTGACTACTATATTACTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-989s1c1
Sequence:CCGGCGCTGGATATAGCTTTGAGAACTCGAGTTCTCAAAGCTATATCCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-639s1c1
Sequence:CCGGCGGGACTTAAAGCCTAGTAATCTCGAGATTACTAGGCTTTAAGTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-528s1c1
Sequence:CCGGGCAAATCTTTGCCAAGTGATTCTCGAGAATCACTTGGCAAAGATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-315s1c1
Sequence:CCGGGCAGCTTATGATGCCATTCTTCTCGAGAAGAATGGCATCATAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-1071s1c1
Sequence:CCGGGCAAGAGATTTGTTATCCAAACTCGAGTTTGGATAACAAATCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-369s1c1
Sequence:CCGGCCATTTCAGAATCAGACCCATCTCGAGATGGGTCTGATTCTGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-1353s1c1
Sequence:CCGGGCTCTCAGCATCCATCGTCTTCTCGAGAAGACGATGGATGCTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016700
VALIDATED
MAPK8 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 8
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1071s21c1
Sequence:CCGGGCAAGAGATTTGTTATCCAAACTCGAGTTTGGATAACAAATCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1400s21c1
Sequence:CCGGATGTCCACAGATCCGACTTTGCTCGAGCAAAGTCGGATCTGTGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1275s21c1
Sequence:CCGGGATTTGGAGGAACGAACTAAGCTCGAGCTTAGTTCGTTCCTCCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1242s21c1
Sequence:CCGGGAGTGGAAAGAACTGATATACCTCGAGGTATATCAGTTCTTTCCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-615s21c1
Sequence:CCGGCTTCACTCTGCTGGAATTATTCTCGAGAATAATTCCAGCAGAGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-1377s1c1
Sequence:CCGGCGTCTGTCAATGACATGTCTTCTCGAGAAGACATGTCATTGACAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-1146s1c1
Sequence:CCGGCCATACATCAACGTCTGGTATCTCGAGATACCAGACGTTGATGTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-650s1c1
Sequence:CCGGGCCTAGTAATATAGTAGTCAACTCGAGTTGACTACTATATTACTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-989s1c1
Sequence:CCGGCGCTGGATATAGCTTTGAGAACTCGAGTTCTCAAAGCTATATCCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-639s1c1
Sequence:CCGGCGGGACTTAAAGCCTAGTAATCTCGAGATTACTAGGCTTTAAGTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-528s1c1
Sequence:CCGGGCAAATCTTTGCCAAGTGATTCTCGAGAATCACTTGGCAAAGATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-315s1c1
Sequence:CCGGGCAGCTTATGATGCCATTCTTCTCGAGAAGAATGGCATCATAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-1071s1c1
Sequence:CCGGGCAAGAGATTTGTTATCCAAACTCGAGTTTGGATAACAAATCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-369s1c1
Sequence:CCGGCCATTTCAGAATCAGACCCATCTCGAGATGGGTCTGATTCTGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-1353s1c1
Sequence:CCGGGCTCTCAGCATCCATCGTCTTCTCGAGAAGACGATGGATGCTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016700
VALIDATED
MAPK8 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 8
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1071s21c1
Sequence:CCGGGCAAGAGATTTGTTATCCAAACTCGAGTTTGGATAACAAATCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1400s21c1
Sequence:CCGGATGTCCACAGATCCGACTTTGCTCGAGCAAAGTCGGATCTGTGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1275s21c1
Sequence:CCGGGATTTGGAGGAACGAACTAAGCTCGAGCTTAGTTCGTTCCTCCAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-1242s21c1
Sequence:CCGGGAGTGGAAAGAACTGATATACCTCGAGGTATATCAGTTCTTTCCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016700.4-615s21c1
Sequence:CCGGCTTCACTCTGCTGGAATTATTCTCGAGAATAATTCCAGCAGAGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-1377s1c1
Sequence:CCGGCGTCTGTCAATGACATGTCTTCTCGAGAAGACATGTCATTGACAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-1146s1c1
Sequence:CCGGCCATACATCAACGTCTGGTATCTCGAGATACCAGACGTTGATGTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-650s1c1
Sequence:CCGGGCCTAGTAATATAGTAGTCAACTCGAGTTGACTACTATATTACTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-989s1c1
Sequence:CCGGCGCTGGATATAGCTTTGAGAACTCGAGTTCTCAAAGCTATATCCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-639s1c1
Sequence:CCGGCGGGACTTAAAGCCTAGTAATCTCGAGATTACTAGGCTTTAAGTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-528s1c1
Sequence:CCGGGCAAATCTTTGCCAAGTGATTCTCGAGAATCACTTGGCAAAGATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-315s1c1
Sequence:CCGGGCAGCTTATGATGCCATTCTTCTCGAGAAGAATGGCATCATAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-1071s1c1
Sequence:CCGGGCAAGAGATTTGTTATCCAAACTCGAGTTTGGATAACAAATCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016700.2-369s1c1
Sequence:CCGGCCATTTCAGAATCAGACCCATCTCGAGATGGGTCTGATTCTGAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016700.2-1353s1c1
Sequence:CCGGGCTCTCAGCATCCATCGTCTTCTCGAGAAGACGATGGATGCTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)