EMAIL THIS PAGE TO A FRIEND

MAPK8IP2

mitogen-activated protein kinase 8 interacting protein 2

94 Gene Product Result for
Synonyms: IB2 JIP2 PRKM8IPL
UniProtKB ID: Q13387, Q96G62, Q99771, Q9NZ59, Q9UKQ4
Gene ID:
Human(23542) Summary: The protein encoded by this gene is closely related to MAPK8IP1/IB1/JIP-1, a scaffold protein that is involved in the c-Jun amino-terminal kinase signaling pathway. This protein is expressed in brain and pancreatic cells. It has been shown to interact with, and regulate the activity of MAPK8/JNK1, and MAP2K7/MKK7 kinases. This protein thus is thought to function as a regulator of signal transduction by protein kinase cascade in brain and pancreatic beta-cells. Alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
Mouse(60597) mitogen-activated protein kinase 8 interacting protein 2
Rat(315220) mitogen-activated protein kinase 8 interacting protein 2
naked mole-rat(101712713) mitogen-activated protein kinase 8 interacting protein 2
domestic guinea pig(100724140) mitogen-activated protein kinase 8 interacting protein 2
sheep(101119037) mitogen-activated protein kinase 8 interacting protein 2
Zebrafish(561262) mitogen-activated protein kinase 8 interacting protein 2
dog(481183) mitogen-activated protein kinase 8 interacting protein 2
domestic cat(101085733) mitogen-activated protein kinase 8 interacting protein 2
cow(618893) mitogen-activated protein kinase 8 interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501001 Anti-JIP2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA034780 Anti-MAPK8IP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2701087 Anti-MAPK8IP2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, western blot pricing
SAB5201509 Monoclonal Anti-Jip2/Ib2 - Alkaline Phosphatase antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201510 Monoclonal Anti-Jip2/Ib2 - Apc antibody produced in mouse clone S135-37, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201501 Monoclonal Anti-Jip2/Ib2 - Atto 390 antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201502 Monoclonal Anti-Jip2/Ib2 - Atto 488 antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201503 Monoclonal Anti-Jip2/Ib2 - Atto 565 antibody produced in mouse clone S135-37, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201504 Monoclonal Anti-Jip2/Ib2 - Atto 594 antibody produced in mouse clone S135-37, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201505 Monoclonal Anti-Jip2/Ib2 - Atto 633 antibody produced in mouse clone S135-37, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201506 Monoclonal Anti-Jip2/Ib2 - Atto 655 antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201507 Monoclonal Anti-Jip2/Ib2 - Atto 680 antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201508 Monoclonal Anti-Jip2/Ib2 - Atto 700 antibody produced in mouse clone S135-37, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201511 Monoclonal Anti-Jip2/Ib2 - Biotin antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201512 Monoclonal Anti-Jip2/Ib2 - Fitc antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201513 Monoclonal Anti-Jip2/Ib2 - Hrp antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201514 Monoclonal Anti-Jip2/Ib2 - Pe/Atto 594 antibody produced in mouse clone S135-37, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201515 Monoclonal Anti-Jip2/Ib2 - Percp antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201516 Monoclonal Anti-Jip2/Ib2 - Rpe antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201517 Monoclonal Anti-Jip2/Ib2 - Streptavidin antibody produced in mouse clone S135-37, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201500 Monoclonal Anti-Jip2/Ib2 antibody produced in mouse clone S135-37, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S8307 SB 203580 solid, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012324 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021921 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021921 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021921 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135051 MISSION® esiRNA esiRNA human MAPK8IP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012324 Rosetta Predictions human pricing
NM_016431 Rosetta Predictions human pricing
NM_139124 Rosetta Predictions human pricing
XM_001055248 Rosetta Predictions rat pricing
XM_235565 Rosetta Predictions rat pricing
NM_021921 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153848 predicted 1832
2 SASI_Hs01_00153849 predicted 2415
3 SASI_Hs02_00344111 predicted 2890
4 SASI_Hs02_00344112 predicted 906
5 SASI_Hs01_00153850 predicted 2216
6 SASI_Hs01_00153851 predicted 3008
7 SASI_Hs01_00153852 predicted 2953
8 SASI_Hs01_00153853 predicted 2232
9 SASI_Hs01_00153854 predicted 3011
10 SASI_Hs01_00153856 predicted 2964
11 SASI_Hs01_00153855 predicted 1825
12 SASI_Hs01_00153857 predicted 2906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085213 predicted 1634
2 SASI_Hs01_00085214 predicted 2213
3 SASI_Hs02_00349456 predicted 2689
4 SASI_Hs01_00085215 predicted 2015
5 SASI_Hs01_00085216 predicted 2813
6 SASI_Hs01_00085217 predicted 2759
7 SASI_Hs01_00085218 predicted 2039
8 SASI_Hs01_00085219 predicted 2808
9 SASI_Hs01_00085221 predicted 2772
10 SASI_Hs02_00349457 predicted 1875
11 SASI_Hs01_00085220 predicted 1626
12 SASI_Hs01_00085222 predicted 2700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065977 predicted 687
2 SASI_Hs01_00065978 predicted 1276
3 SASI_Hs01_00065979 predicted 1082
4 SASI_Hs01_00065980 predicted 1864
5 SASI_Hs01_00065981 predicted 1817
6 SASI_Hs01_00065982 predicted 1099
7 SASI_Hs01_00065983 predicted 1872
8 SASI_Hs01_00065984 predicted 675
9 SASI_Hs01_00065985 predicted 1832
10 SASI_Hs01_00065986 predicted 1758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278936 predicted 2160
2 SASI_Rn02_00278937 predicted 2773
3 SASI_Rn02_00278938 predicted 2166
4 SASI_Rn02_00278939 predicted 968
5 SASI_Rn02_00278940 predicted 2412
6 SASI_Rn02_00278941 predicted 2413
7 SASI_Rn02_00278942 predicted 1109
8 SASI_Rn02_00278943 predicted 2298
9 SASI_Rn02_00278944 predicted 1523
10 SASI_Rn02_00278945 predicted 2547
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389479 predicted 2442
2 SASI_Rn02_00389480 predicted 3053
3 SASI_Rn02_00389481 predicted 2454
4 SASI_Rn02_00389482 predicted 1257
5 SASI_Rn02_00389483 predicted 2693
6 SASI_Rn02_00389484 predicted 2690
7 SASI_Rn02_00389485 predicted 1389
8 SASI_Rn02_00389486 predicted 2578
9 SASI_Rn02_00389487 predicted 1805
10 SASI_Rn02_00389488 predicted 2825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107026 predicted 768
2 SASI_Mm01_00107027 predicted 1822
3 SASI_Mm01_00107030 predicted 2432
4 SASI_Mm01_00107031 predicted 2883
5 SASI_Mm02_00326464 predicted 2962
6 SASI_Mm02_00326465 predicted 2979
7 SASI_Mm01_00107032 predicted 1088
8 SASI_Mm01_00107033 predicted 2074
9 SASI_Mm01_00107034 predicted 786
10 SASI_Mm01_00107035 predicted 965
11 SASI_Mm01_00107028 predicted 2978
12 SASI_Mm01_00107029 predicted 2605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012324
MAPK8IP2 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 8 interacting protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012324.3-2906s21c1
Sequence:CCGGTATCCTCTATTCTTCACTTTGCTCGAGCAAAGTGAAGAATAGAGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012324.3-357s21c1
Sequence:CCGGGTTTGAGATGATCGATGACAACTCGAGTTGTCATCGATCATCTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-570s1c1
Sequence:CCGGCCTAAACAACAACGGAGGCTTCTCGAGAAGCCTCCGTTGTTGTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-2361s1c1
Sequence:CCGGCAGCCATTTCTTCCAGATGAACTCGAGTTCATCTGGAAGAAATGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-205s1c1
Sequence:CCGGGAAGAATTTGACGACGAAGATCTCGAGATCTTCGTCGTCAAATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-2373s1c1
Sequence:CCGGCCAGATGAAGAACATCTCCTTCTCGAGAAGGAGATGTTCTTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-1836s1c1
Sequence:CCGGCAAGAAGTTCCTCAATGTCTTCTCGAGAAGACATTGAGGAACTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012324
MAPK8IP2 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 8 interacting protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012324.3-2906s21c1
Sequence:CCGGTATCCTCTATTCTTCACTTTGCTCGAGCAAAGTGAAGAATAGAGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012324.3-357s21c1
Sequence:CCGGGTTTGAGATGATCGATGACAACTCGAGTTGTCATCGATCATCTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-570s1c1
Sequence:CCGGCCTAAACAACAACGGAGGCTTCTCGAGAAGCCTCCGTTGTTGTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-2361s1c1
Sequence:CCGGCAGCCATTTCTTCCAGATGAACTCGAGTTCATCTGGAAGAAATGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-205s1c1
Sequence:CCGGGAAGAATTTGACGACGAAGATCTCGAGATCTTCGTCGTCAAATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-2373s1c1
Sequence:CCGGCCAGATGAAGAACATCTCCTTCTCGAGAAGGAGATGTTCTTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-1836s1c1
Sequence:CCGGCAAGAAGTTCCTCAATGTCTTCTCGAGAAGACATTGAGGAACTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012324
MAPK8IP2 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 8 interacting protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012324.3-2906s21c1
Sequence:CCGGTATCCTCTATTCTTCACTTTGCTCGAGCAAAGTGAAGAATAGAGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012324.3-357s21c1
Sequence:CCGGGTTTGAGATGATCGATGACAACTCGAGTTGTCATCGATCATCTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-570s1c1
Sequence:CCGGCCTAAACAACAACGGAGGCTTCTCGAGAAGCCTCCGTTGTTGTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-2361s1c1
Sequence:CCGGCAGCCATTTCTTCCAGATGAACTCGAGTTCATCTGGAAGAAATGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-205s1c1
Sequence:CCGGGAAGAATTTGACGACGAAGATCTCGAGATCTTCGTCGTCAAATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-2373s1c1
Sequence:CCGGCCAGATGAAGAACATCTCCTTCTCGAGAAGGAGATGTTCTTCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012324.2-1836s1c1
Sequence:CCGGCAAGAAGTTCCTCAATGTCTTCTCGAGAAGACATTGAGGAACTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021921
MAPK8IP2 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 8 interacting protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021921.3-1300s21c1
Sequence:CCGGGGATGACACCAACAGCGAATACTCGAGTATTCGCTGTTGGTGTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021921.3-771s21c1
Sequence:CCGGATAACAACAACGGAGGCTTTACTCGAGTAAAGCCTCCGTTGTTGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021921.3-1114s21c1
Sequence:CCGGGCGCATGATCTCGTCCATTTCCTCGAGGAAATGGACGAGATCATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021921.2-2969s1c1
Sequence:CCGGGCCCTTCTCTTGTGATTTATACTCGAGTATAAATCACAAGAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-296s1c1
Sequence:CCGGCCCTATTTGTTCCTTCCAAGACTCGAGTCTTGGAAGGAACAAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-290s1c1
Sequence:CCGGGCCACACCCTATTTGTTCCTTCTCGAGAAGGAACAAATAGGGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-1616s1c1
Sequence:CCGGGCTGGTGTACGATGCAGTTAACTCGAGTTAACTGCATCGTACACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-311s1c1
Sequence:CCGGCCAAGATGATTTCCAGGAGTTCTCGAGAACTCCTGGAAATCATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021921
MAPK8IP2 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 8 interacting protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021921.3-1300s21c1
Sequence:CCGGGGATGACACCAACAGCGAATACTCGAGTATTCGCTGTTGGTGTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021921.3-771s21c1
Sequence:CCGGATAACAACAACGGAGGCTTTACTCGAGTAAAGCCTCCGTTGTTGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021921.3-1114s21c1
Sequence:CCGGGCGCATGATCTCGTCCATTTCCTCGAGGAAATGGACGAGATCATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021921.2-2969s1c1
Sequence:CCGGGCCCTTCTCTTGTGATTTATACTCGAGTATAAATCACAAGAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-296s1c1
Sequence:CCGGCCCTATTTGTTCCTTCCAAGACTCGAGTCTTGGAAGGAACAAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-290s1c1
Sequence:CCGGGCCACACCCTATTTGTTCCTTCTCGAGAAGGAACAAATAGGGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-1616s1c1
Sequence:CCGGGCTGGTGTACGATGCAGTTAACTCGAGTTAACTGCATCGTACACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-311s1c1
Sequence:CCGGCCAAGATGATTTCCAGGAGTTCTCGAGAACTCCTGGAAATCATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021921
MAPK8IP2 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 8 interacting protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021921.3-1300s21c1
Sequence:CCGGGGATGACACCAACAGCGAATACTCGAGTATTCGCTGTTGGTGTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021921.3-771s21c1
Sequence:CCGGATAACAACAACGGAGGCTTTACTCGAGTAAAGCCTCCGTTGTTGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021921.3-1114s21c1
Sequence:CCGGGCGCATGATCTCGTCCATTTCCTCGAGGAAATGGACGAGATCATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021921.2-2969s1c1
Sequence:CCGGGCCCTTCTCTTGTGATTTATACTCGAGTATAAATCACAAGAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-296s1c1
Sequence:CCGGCCCTATTTGTTCCTTCCAAGACTCGAGTCTTGGAAGGAACAAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-290s1c1
Sequence:CCGGGCCACACCCTATTTGTTCCTTCTCGAGAAGGAACAAATAGGGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-1616s1c1
Sequence:CCGGGCTGGTGTACGATGCAGTTAACTCGAGTTAACTGCATCGTACACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021921.2-311s1c1
Sequence:CCGGCCAAGATGATTTCCAGGAGTTCTCGAGAACTCCTGGAAATCATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)