EMAIL THIS PAGE TO A FRIEND

MAPK8IP3

mitogen-activated protein kinase 8 interacting protein 3

119 Gene Product Result for
Synonyms: JIP3 JSAP1 SYD2 syd
Gene ID:
Human(23162) Summary: The protein encoded by this gene shares similarity with the product of Drosophila syd gene, required for the functional interaction of kinesin I with axonal cargo. Studies of the similar gene in mouse suggested that this protein may interact with, and regulate the activity of numerous protein kinases of the JNK signaling pathway, and thus function as a scaffold protein in neuronal cells. The C. elegans counterpart of this gene is found to regulate synaptic vesicle transport possibly by integrating JNK signaling and kinesin-1 transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(30957) mitogen-activated protein kinase 8 interacting protein 3
Rat(302983) mitogen-activated protein kinase 8 interacting protein 3
Zebrafish(100318355) mitogen-activated protein kinase 8 interacting protein 3
chicken(426986) mitogen-activated protein kinase 8 interacting protein 3
cow(537598) mitogen-activated protein kinase 8 interacting protein 3
Horse(100067809) mitogen-activated protein kinase 8 interacting protein 3
domestic cat(101086776) mitogen-activated protein kinase 8 interacting protein 3
dog(100684766) mitogen-activated protein kinase 8 interacting protein 3
sheep(101110293) mitogen-activated protein kinase 8 interacting protein 3
domestic guinea pig(100725966) mitogen-activated protein kinase 8 interacting protein 3
naked mole-rat(101716066) mitogen-activated protein kinase 8 interacting protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015133 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040439 Rosetta Predictions human pricing
NM_015133 Rosetta Predictions human pricing
NM_001100673 Rosetta Predictions rat pricing
NM_013931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050164 predicted 536
2 SASI_Hs01_00050165 predicted 1607
3 SASI_Hs01_00050167 predicted 1622
4 SASI_Hs01_00050168 predicted 3476
5 SASI_Hs01_00050169 predicted 3201
6 SASI_Hs02_00308969 predicted 4068
7 SASI_Hs01_00050170 predicted 1607
8 SASI_Hs01_00050171 predicted 1099
9 SASI_Hs01_00050172 predicted 3037
10 SASI_Hs02_00308970 predicted 1618
11 SASI_Hs01_00050166 predicted 446
12 SASI_Hs01_00050173 predicted 1884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164614 predicted 534
2 SASI_Hs01_00164615 predicted 1621
3 SASI_Hs01_00164617 predicted 1635
4 SASI_Hs01_00164618 predicted 3494
5 SASI_Hs01_00164619 predicted 3219
6 SASI_Hs02_00347058 predicted 4090
7 SASI_Hs01_00164620 predicted 1632
8 SASI_Hs01_00164621 predicted 1099
9 SASI_Hs01_00164622 predicted 3056
10 SASI_Hs02_00347059 predicted 1638
11 SASI_Hs01_00164616 predicted 451
12 SASI_Hs01_00164623 predicted 1911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210278 predicted 1660
2 SASI_Rn02_00210279 predicted 964
3 SASI_Rn02_00210280 predicted 2327
4 SASI_Rn02_00210281 predicted 1405
5 SASI_Rn02_00210282 predicted 516
6 SASI_Rn02_00210283 predicted 3175
7 SASI_Rn02_00210284 predicted 1901
8 SASI_Rn02_00210285 predicted 1431
9 SASI_Rn02_00210286 predicted 305
10 SASI_Rn02_00210287 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201597 predicted 1074
2 SASI_Mm01_00201598 predicted 1623
3 SASI_Mm01_00201599 predicted 1627
4 SASI_Mm02_00323030 predicted 2923
5 SASI_Mm01_00201602 predicted 3842
6 SASI_Mm01_00201603 predicted 4047
7 SASI_Mm01_00201604 predicted 3982
8 SASI_Mm02_00323031 predicted 1559
9 SASI_Mm01_00201605 predicted 851
10 SASI_Mm01_00201606 predicted 3335
11 SASI_Mm01_00201600 predicted 1540
12 SASI_Mm01_00201601 predicted 3293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013931
MAPK8IP3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 8 interacting protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013931.1-4555s1c1
Sequence:CCGGGCTCCTGATTTCCAACCCTTTCTCGAGAAAGGGTTGGAAATCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013931.1-2932s1c1
Sequence:CCGGCCAGTGAGAATGGGTCAGAATCTCGAGATTCTGACCCATTCTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013931.1-428s1c1
Sequence:CCGGCGAGGAGAAATTCATCGAATTCTCGAGAATTCGATGAATTTCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013931.1-427s1c1
Sequence:CCGGCCGAGGAGAAATTCATCGAATCTCGAGATTCGATGAATTTCTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-3563s21c1
Sequence:CCGGGCATCACAGCCTTACTCATTGCTCGAGCAATGAGTAAGGCTGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-3285s21c1
Sequence:CCGGTGTTGTGAATGACCGAGTTTGCTCGAGCAAACTCGGTCATTCACAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-3501s21c1
Sequence:CCGGGGACATTGAGCCCTATGTTAGCTCGAGCTAACATAGGGCTCAATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-1139s21c1
Sequence:CCGGGGTCCGATGTTCAGGACATTACTCGAGTAATGTCCTGAACATCGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-1096s21c1
Sequence:CCGGGAGATGCGGAACGTCAGTATCCTCGAGGATACTGACGTTCCGCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013931
MAPK8IP3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 8 interacting protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013931.1-4555s1c1
Sequence:CCGGGCTCCTGATTTCCAACCCTTTCTCGAGAAAGGGTTGGAAATCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013931.1-2932s1c1
Sequence:CCGGCCAGTGAGAATGGGTCAGAATCTCGAGATTCTGACCCATTCTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013931.1-428s1c1
Sequence:CCGGCGAGGAGAAATTCATCGAATTCTCGAGAATTCGATGAATTTCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013931.1-427s1c1
Sequence:CCGGCCGAGGAGAAATTCATCGAATCTCGAGATTCGATGAATTTCTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-3563s21c1
Sequence:CCGGGCATCACAGCCTTACTCATTGCTCGAGCAATGAGTAAGGCTGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-3285s21c1
Sequence:CCGGTGTTGTGAATGACCGAGTTTGCTCGAGCAAACTCGGTCATTCACAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-3501s21c1
Sequence:CCGGGGACATTGAGCCCTATGTTAGCTCGAGCTAACATAGGGCTCAATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-1139s21c1
Sequence:CCGGGGTCCGATGTTCAGGACATTACTCGAGTAATGTCCTGAACATCGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-1096s21c1
Sequence:CCGGGAGATGCGGAACGTCAGTATCCTCGAGGATACTGACGTTCCGCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013931
MAPK8IP3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 8 interacting protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013931.1-4555s1c1
Sequence:CCGGGCTCCTGATTTCCAACCCTTTCTCGAGAAAGGGTTGGAAATCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013931.1-2932s1c1
Sequence:CCGGCCAGTGAGAATGGGTCAGAATCTCGAGATTCTGACCCATTCTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013931.1-428s1c1
Sequence:CCGGCGAGGAGAAATTCATCGAATTCTCGAGAATTCGATGAATTTCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013931.1-427s1c1
Sequence:CCGGCCGAGGAGAAATTCATCGAATCTCGAGATTCGATGAATTTCTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-3563s21c1
Sequence:CCGGGCATCACAGCCTTACTCATTGCTCGAGCAATGAGTAAGGCTGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-3285s21c1
Sequence:CCGGTGTTGTGAATGACCGAGTTTGCTCGAGCAAACTCGGTCATTCACAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-3501s21c1
Sequence:CCGGGGACATTGAGCCCTATGTTAGCTCGAGCTAACATAGGGCTCAATGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-1139s21c1
Sequence:CCGGGGTCCGATGTTCAGGACATTACTCGAGTAATGTCCTGAACATCGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013931.4-1096s21c1
Sequence:CCGGGAGATGCGGAACGTCAGTATCCTCGAGGATACTGACGTTCCGCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015133
MAPK8IP3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 8 interacting protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-651s1c1
Sequence:CCGGGCACATTGAGAGGTCCAAGATCTCGAGATCTTGGACCTCTCAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-3219s1c1
Sequence:CCGGTCTGAGCAACTATCACCTAATCTCGAGATTAGGTGATAGTTGCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-1621s1c1
Sequence:CCGGGCGGAGGATGTAAGCAGCTATCTCGAGATAGCTGCTTACATCCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-1426s1c1
Sequence:CCGGGCCTTGAATGTGGTGAAGAATCTCGAGATTCTTCACCACATTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-3359s1c1
Sequence:CCGGCCATGACTCCACAGAAGTCATCTCGAGATGACTTCTGTGGAGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015133.3-3827s21c1
Sequence:CCGGGCGATGCCGTGAAGTTCTTTGCTCGAGCAAAGAACTTCACGGCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015133.3-1338s21c1
Sequence:CCGGGTTCTCAGTGCGCGATGATTTCTCGAGAAATCATCGCGCACTGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015133.3-3343s21c1
Sequence:CCGGATGCAGATAGAGAAGTCATTTCTCGAGAAATGACTTCTCTATCTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015133
MAPK8IP3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 8 interacting protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-651s1c1
Sequence:CCGGGCACATTGAGAGGTCCAAGATCTCGAGATCTTGGACCTCTCAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-3219s1c1
Sequence:CCGGTCTGAGCAACTATCACCTAATCTCGAGATTAGGTGATAGTTGCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-1621s1c1
Sequence:CCGGGCGGAGGATGTAAGCAGCTATCTCGAGATAGCTGCTTACATCCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-1426s1c1
Sequence:CCGGGCCTTGAATGTGGTGAAGAATCTCGAGATTCTTCACCACATTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-3359s1c1
Sequence:CCGGCCATGACTCCACAGAAGTCATCTCGAGATGACTTCTGTGGAGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015133.3-3827s21c1
Sequence:CCGGGCGATGCCGTGAAGTTCTTTGCTCGAGCAAAGAACTTCACGGCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015133.3-1338s21c1
Sequence:CCGGGTTCTCAGTGCGCGATGATTTCTCGAGAAATCATCGCGCACTGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015133.3-3343s21c1
Sequence:CCGGATGCAGATAGAGAAGTCATTTCTCGAGAAATGACTTCTCTATCTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015133
MAPK8IP3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 8 interacting protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-651s1c1
Sequence:CCGGGCACATTGAGAGGTCCAAGATCTCGAGATCTTGGACCTCTCAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-3219s1c1
Sequence:CCGGTCTGAGCAACTATCACCTAATCTCGAGATTAGGTGATAGTTGCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-1621s1c1
Sequence:CCGGGCGGAGGATGTAAGCAGCTATCTCGAGATAGCTGCTTACATCCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-1426s1c1
Sequence:CCGGGCCTTGAATGTGGTGAAGAATCTCGAGATTCTTCACCACATTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015133.2-3359s1c1
Sequence:CCGGCCATGACTCCACAGAAGTCATCTCGAGATGACTTCTGTGGAGTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015133.3-3827s21c1
Sequence:CCGGGCGATGCCGTGAAGTTCTTTGCTCGAGCAAAGAACTTCACGGCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015133.3-1338s21c1
Sequence:CCGGGTTCTCAGTGCGCGATGATTTCTCGAGAAATCATCGCGCACTGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015133.3-3343s21c1
Sequence:CCGGATGCAGATAGAGAAGTCATTTCTCGAGAAATGACTTCTCTATCTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)