EMAIL THIS PAGE TO A FRIEND

MAPK9

mitogen-activated protein kinase 9

192 Gene Product Result for
Synonyms: JNK-55 JNK2 JNK2A JNK2ALPHA JNK2B JNK2BETA PRKM9 SAPK SAPK1a p54a p54aSAPK
Gene ID:
Human(5601) Summary: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]
Mouse(26420) mitogen-activated protein kinase 9
Rat(50658) mitogen-activated protein kinase 9
Zebrafish(100149273) mitogen-activated protein kinase 9
cow(534125) mitogen-activated protein kinase 9
Horse(100057961) mitogen-activated protein kinase 9
domestic cat(101084765) mitogen-activated protein kinase 9
dog(474652) mitogen-activated protein kinase 9
chicken(395983) mitogen-activated protein kinase 9
naked mole-rat(101698286) mitogen-activated protein kinase 9
Domestic Rabbit(100342664) mitogen-activated protein kinase 9
domestic guinea pig(100714249) mitogen-activated protein kinase 9
sheep(101120826) mitogen-activated protein kinase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306376 ANTI-JNK2 (MAPK9)(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
M7573 Anti-MAPK9 (276-290) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300497 Anti-MAPK9 (Ab-183) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
GW22791 Anti-MAPK9 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB2502040 Anti-MAPK9 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat, canine
ELISA, western blot pricing
SAB2502041 Anti-MAPK9 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, human, rat, pig
ELISA, western blot pricing
SAB1412229 ANTI-MAPK9 antibody produced in mouse clone 3C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4502402 Anti-MAPK9 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB2107297 Anti-MAPK9 antibody produced in rabbit affinity isolated antibody human, horse, rabbit, mouse, guinea pig
ELISA, western blot pricing
SAB1302485 ANTI-MOUSE MAPK9 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4503929 Anti-phospho-JNK1/2/3 (pThr183+Tyr185) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300261 Anti-phospho-MAPK8/MAPK9/MAPK10 (pThr183/pTyr185) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, western blot pricing
SAB4300198 Anti-phospho-MAPK9 (pThr183) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4504449 Anti-phospho-SAPK/JNK (pThr183) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504450 Anti-phospho-SAPK/JNK (pTyr185) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
WH0005601M1 Monoclonal Anti-MAPK9 antibody produced in mouse clone 1C1-3A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404250 Monoclonal Anti-MAPK9, (C-terminal) antibody produced in mouse clone 2F8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016961 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016961 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016961 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_002752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002752 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002752 siRNAs that have been validated in the lab human pricing
NM_139068 siRNAs that have been validated in the lab human pricing
NM_139069 siRNAs that have been validated in the lab human pricing
NM_139070 siRNAs that have been validated in the lab human pricing
NM_017322 Rosetta Predictions rat pricing
NM_016961 Rosetta Predictions mouse pricing
NM_207692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002752 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143827 validated 1413
2 SASI_Hs01_00143828 predicted 1639
3 SASI_Hs01_00143830 predicted 1418
4 SASI_Hs02_00334368 predicted 1628
5 SASI_Hs01_00143831 predicted 1436
6 SASI_Hs01_00143832 predicted 364
7 SASI_Hs01_00143833 predicted 381
8 SASI_Hs01_00143834 predicted 1460
9 SASI_Hs01_00143835 predicted 1453
10 SASI_Hs02_00334369 predicted 447
11 SASI_Hs01_00143829 predicted 1621
12 SASI_Hs01_00143836 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139068 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216214 validated 1416
2 SASI_Hs01_00216215 predicted 1638
3 SASI_Hs01_00216217 predicted 1415
4 SASI_Hs02_00364121 predicted 1634
5 SASI_Hs01_00216218 predicted 1437
6 SASI_Hs01_00216219 predicted 372
7 SASI_Hs01_00216220 predicted 385
8 SASI_Hs01_00216221 predicted 1464
9 SASI_Hs01_00216222 predicted 1455
10 SASI_Hs02_00364122 predicted 449
11 SASI_Hs01_00216216 predicted 1633
12 SASI_Hs01_00216223 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139069 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141792 validated 1417
2 SASI_Hs01_00141793 predicted 1637
3 SASI_Hs01_00141795 predicted 1417
4 SASI_Hs02_00364123 predicted 1634
5 SASI_Hs01_00141796 predicted 1443
6 SASI_Hs01_00141797 predicted 368
7 SASI_Hs01_00141798 predicted 382
8 SASI_Hs01_00141799 predicted 1467
9 SASI_Hs01_00141800 predicted 1453
10 SASI_Hs02_00364124 predicted 448
11 SASI_Hs01_00141794 predicted 1631
12 SASI_Hs01_00141801 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139070 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190806 validated 1411
2 SASI_Hs01_00190807 predicted 1631
3 SASI_Hs01_00190809 predicted 1419
4 SASI_Hs02_00364125 predicted 1622
5 SASI_Hs01_00190810 predicted 1436
6 SASI_Hs01_00190811 predicted 366
7 SASI_Hs01_00190812 predicted 377
8 SASI_Hs01_00190813 predicted 1456
9 SASI_Hs01_00190814 predicted 1447
10 SASI_Hs02_00364126 predicted 453
11 SASI_Hs01_00190808 predicted 1627
12 SASI_Hs01_00190815 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072167 predicted 345
2 SASI_Rn01_00072168 predicted 1144
3 SASI_Rn01_00072169 predicted 336
4 SASI_Rn01_00072170 predicted 693
5 SASI_Rn01_00072171 predicted 243
6 SASI_Rn01_00072172 predicted 557
7 SASI_Rn01_00072173 predicted 462
8 SASI_Rn01_00072174 predicted 968
9 SASI_Rn01_00072175 predicted 610
10 SASI_Rn01_00072176 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037992 predicted 1637
2 SASI_Mm02_00323811 predicted 1742
3 SASI_Mm01_00037993 predicted 1773
4 SASI_Mm01_00037994 predicted 1777
5 SASI_Mm02_00323812 predicted 526
6 SASI_Mm01_00037996 predicted 1687
7 SASI_Mm01_00037997 predicted 607
8 SASI_Mm01_00037998 predicted 1637
9 SASI_Mm01_00037999 predicted 314
10 SASI_Mm01_00038000 predicted 600
11 SASI_Mm01_00037995 predicted 384
12 SASI_Mm01_00038001 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126799 predicted 1633
2 SASI_Mm01_00126800 predicted 1935
3 SASI_Mm02_00352232 predicted 1736
4 SASI_Mm01_00126801 predicted 1760
5 SASI_Mm01_00126802 predicted 1766
6 SASI_Mm01_00126803 predicted 1675
7 SASI_Mm01_00126804 predicted 604
8 SASI_Mm01_00126805 predicted 315
9 SASI_Mm01_00126806 predicted 597
10 SASI_Mm01_00126807 predicted 465
11 SASI_Mm01_00126808 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016961
VALIDATED
MAPK9 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 9
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-324s21c1
Sequence:CCGGCTCAACTTTCACTGTTCTAAACTCGAGTTTAGAACAGTGAAAGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-1429s21c1
Sequence:CCGGCTACTCCTTCTCAGTCGTCATCTCGAGATGACGACTGAGAAGGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-1059s21c1
Sequence:CCGGCAGACCAAAGTACCCTGGAATCTCGAGATTCCAGGGTACTTTGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-732s21c1
Sequence:CCGGGCCTAGCAACATTGTAGTAAACTCGAGTTTACTACAATGTTGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016961.2-2358s1c1
Sequence:CCGGCCACAGAACTTCACCTTCTTTCTCGAGAAAGAAGGTGAAGTTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-607s1c1
Sequence:CCGGGCTAACTTATGTCAGGTTATTCTCGAGAATAACCTGACATAAGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-316s1c1
Sequence:CCGGGCGGACTCAACTTTCACTGTTCTCGAGAACAGTGAAAGTTGAGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-1056s1c1
Sequence:CCGGCAGACCAAAGTACCCTGGAATCTCGAGATTCCAGGGTACTTTGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-1173s1c1
Sequence:CCGGGCTAGTGATTGATCCAGACAACTCGAGTTGTCTGGATCAATCACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-60s1c1
Sequence:CCGGCTCAACTTTCACTGTTCTAAACTCGAGTTTAGAACAGTGAAAGTTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016961.1-963s1c1
Sequence:CCGGCCCGTATATTACTGTTTGGTACTCGAGTACCAAACAGTAATATACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-655s1c1
Sequence:CCGGGCAGAAATGGTCCTCCATAAACTCGAGTTTATGGAGGACCATTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-468s1c1
Sequence:CCGGGCCTAGCAACATTGTAGTAAACTCGAGTTTACTACAATGTTGCTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-1165s1c1
Sequence:CCGGCTACTCCTTCTCAGTCGTCATCTCGAGATGACGACTGAGAAGGAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016961
VALIDATED
MAPK9 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 9
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-324s21c1
Sequence:CCGGCTCAACTTTCACTGTTCTAAACTCGAGTTTAGAACAGTGAAAGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-1429s21c1
Sequence:CCGGCTACTCCTTCTCAGTCGTCATCTCGAGATGACGACTGAGAAGGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-1059s21c1
Sequence:CCGGCAGACCAAAGTACCCTGGAATCTCGAGATTCCAGGGTACTTTGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-732s21c1
Sequence:CCGGGCCTAGCAACATTGTAGTAAACTCGAGTTTACTACAATGTTGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016961.2-2358s1c1
Sequence:CCGGCCACAGAACTTCACCTTCTTTCTCGAGAAAGAAGGTGAAGTTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-607s1c1
Sequence:CCGGGCTAACTTATGTCAGGTTATTCTCGAGAATAACCTGACATAAGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-316s1c1
Sequence:CCGGGCGGACTCAACTTTCACTGTTCTCGAGAACAGTGAAAGTTGAGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-1056s1c1
Sequence:CCGGCAGACCAAAGTACCCTGGAATCTCGAGATTCCAGGGTACTTTGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-1173s1c1
Sequence:CCGGGCTAGTGATTGATCCAGACAACTCGAGTTGTCTGGATCAATCACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-60s1c1
Sequence:CCGGCTCAACTTTCACTGTTCTAAACTCGAGTTTAGAACAGTGAAAGTTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016961.1-963s1c1
Sequence:CCGGCCCGTATATTACTGTTTGGTACTCGAGTACCAAACAGTAATATACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-655s1c1
Sequence:CCGGGCAGAAATGGTCCTCCATAAACTCGAGTTTATGGAGGACCATTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-468s1c1
Sequence:CCGGGCCTAGCAACATTGTAGTAAACTCGAGTTTACTACAATGTTGCTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-1165s1c1
Sequence:CCGGCTACTCCTTCTCAGTCGTCATCTCGAGATGACGACTGAGAAGGAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016961
VALIDATED
MAPK9 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 9
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-324s21c1
Sequence:CCGGCTCAACTTTCACTGTTCTAAACTCGAGTTTAGAACAGTGAAAGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-1429s21c1
Sequence:CCGGCTACTCCTTCTCAGTCGTCATCTCGAGATGACGACTGAGAAGGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-1059s21c1
Sequence:CCGGCAGACCAAAGTACCCTGGAATCTCGAGATTCCAGGGTACTTTGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016961.3-732s21c1
Sequence:CCGGGCCTAGCAACATTGTAGTAAACTCGAGTTTACTACAATGTTGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016961.2-2358s1c1
Sequence:CCGGCCACAGAACTTCACCTTCTTTCTCGAGAAAGAAGGTGAAGTTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-607s1c1
Sequence:CCGGGCTAACTTATGTCAGGTTATTCTCGAGAATAACCTGACATAAGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-316s1c1
Sequence:CCGGGCGGACTCAACTTTCACTGTTCTCGAGAACAGTGAAAGTTGAGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-1056s1c1
Sequence:CCGGCAGACCAAAGTACCCTGGAATCTCGAGATTCCAGGGTACTTTGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.2-1173s1c1
Sequence:CCGGGCTAGTGATTGATCCAGACAACTCGAGTTGTCTGGATCAATCACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-60s1c1
Sequence:CCGGCTCAACTTTCACTGTTCTAAACTCGAGTTTAGAACAGTGAAAGTTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016961.1-963s1c1
Sequence:CCGGCCCGTATATTACTGTTTGGTACTCGAGTACCAAACAGTAATATACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-655s1c1
Sequence:CCGGGCAGAAATGGTCCTCCATAAACTCGAGTTTATGGAGGACCATTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-468s1c1
Sequence:CCGGGCCTAGCAACATTGTAGTAAACTCGAGTTTACTACAATGTTGCTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016961.1-1165s1c1
Sequence:CCGGCTACTCCTTCTCAGTCGTCATCTCGAGATGACGACTGAGAAGGAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139069
VALIDATED
MAPK9 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 9
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-726s1c1
Sequence:CCGGCGGGAAGAGACTATATTGATCCTCGAGGATCAATATAGTCTCTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-160s1c1
Sequence:CCGGAGGGATTGTTTGTGCTGCATTCTCGAGAATGCAGCACAAACAATCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.x-813s1c1
Sequence:CCGGCTGTGAGGAATTATGTCGAAACTCGAGTTTCGACATAATTCCTCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-356s1c1
Sequence:CCGGGATGTGTATTTGGTTATGGAACTCGAGTTCCATAACCAAATACACATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139069.x-1319s1c1
Sequence:CCGGGCTGTCGATGATAGGTTAGAACTCGAGTTCTAACCTATCATCGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-401s1c1
Sequence:CCGGGTTATTCACATGGAGCTGGATCTCGAGATCCAGCTCCATGTGAATAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.x-261s1c1
Sequence:CCGGATCGTGAACTTGTCCTCTTAACTCGAGTTAAGAGGACAAGTTCACGATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.x-997s1c1
Sequence:CCGGGCGTCACCCATACATCACTGTCTCGAGACAGTGATGTATGGGTGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-178s1c1
Sequence:CCGGATTTGATACAGTTCTTGGGATCTCGAGATCCCAAGAACTGTATCAAATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-812s1c1
Sequence:CCGGACTGTGAGGAATTATGTCGAACTCGAGTTCGACATAATTCCTCACAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-1476s1c1
Sequence:CCGGGATTGCCTGCTTAGATGATAACTCGAGTTATCATCTAAGCAGGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139069.1-869s1c1
Sequence:CCGGCTCTTTCCAGATTGGATATTCCTCGAGGAATATCCAATCTGGAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195736    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139069.1-1629s1c1
Sequence:CCGGCTGTAACTGTTGAGATGTATGCTCGAGCATACATCTCAACAGTTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-509s1c1
Sequence:CCGGCCTAGCAACATTGTTGTGAAACTCGAGTTTCACAACAATGTTGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-387s1c1
Sequence:CCGGCTAACTTATGTCAGGTTATTCCTCGAGGAATAACCTGACATAAGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-482s1c1
Sequence:CCGGGCTGGTATAATTCATAGAGATCTCGAGATCTCTATGAATTATACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139069.1-878s1c1
Sequence:CCGGGATTGGATATTCCCATCAGAACTCGAGTTCTGATGGGAATATCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-1740s1c1
Sequence:CCGGGCTTCTGAAGTTATCTCTTAACTCGAGTTAAGAGATAACTTCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139069.1-1146s1c1
Sequence:CCGGGAAGCAAGAATGGTGTTGTAACTCGAGTTACAACACCATTCTTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139069
VALIDATED
MAPK9 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 9
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-726s1c1
Sequence:CCGGCGGGAAGAGACTATATTGATCCTCGAGGATCAATATAGTCTCTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-160s1c1
Sequence:CCGGAGGGATTGTTTGTGCTGCATTCTCGAGAATGCAGCACAAACAATCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.x-813s1c1
Sequence:CCGGCTGTGAGGAATTATGTCGAAACTCGAGTTTCGACATAATTCCTCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-356s1c1
Sequence:CCGGGATGTGTATTTGGTTATGGAACTCGAGTTCCATAACCAAATACACATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139069.x-1319s1c1
Sequence:CCGGGCTGTCGATGATAGGTTAGAACTCGAGTTCTAACCTATCATCGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-401s1c1
Sequence:CCGGGTTATTCACATGGAGCTGGATCTCGAGATCCAGCTCCATGTGAATAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.x-261s1c1
Sequence:CCGGATCGTGAACTTGTCCTCTTAACTCGAGTTAAGAGGACAAGTTCACGATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.x-997s1c1
Sequence:CCGGGCGTCACCCATACATCACTGTCTCGAGACAGTGATGTATGGGTGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-178s1c1
Sequence:CCGGATTTGATACAGTTCTTGGGATCTCGAGATCCCAAGAACTGTATCAAATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-812s1c1
Sequence:CCGGACTGTGAGGAATTATGTCGAACTCGAGTTCGACATAATTCCTCACAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-1476s1c1
Sequence:CCGGGATTGCCTGCTTAGATGATAACTCGAGTTATCATCTAAGCAGGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139069.1-869s1c1
Sequence:CCGGCTCTTTCCAGATTGGATATTCCTCGAGGAATATCCAATCTGGAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195736    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139069.1-1629s1c1
Sequence:CCGGCTGTAACTGTTGAGATGTATGCTCGAGCATACATCTCAACAGTTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-509s1c1
Sequence:CCGGCCTAGCAACATTGTTGTGAAACTCGAGTTTCACAACAATGTTGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-387s1c1
Sequence:CCGGCTAACTTATGTCAGGTTATTCCTCGAGGAATAACCTGACATAAGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-482s1c1
Sequence:CCGGGCTGGTATAATTCATAGAGATCTCGAGATCTCTATGAATTATACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139069.1-878s1c1
Sequence:CCGGGATTGGATATTCCCATCAGAACTCGAGTTCTGATGGGAATATCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-1740s1c1
Sequence:CCGGGCTTCTGAAGTTATCTCTTAACTCGAGTTAAGAGATAACTTCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139069.1-1146s1c1
Sequence:CCGGGAAGCAAGAATGGTGTTGTAACTCGAGTTACAACACCATTCTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139069
VALIDATED
MAPK9 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 9
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-726s1c1
Sequence:CCGGCGGGAAGAGACTATATTGATCCTCGAGGATCAATATAGTCTCTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-160s1c1
Sequence:CCGGAGGGATTGTTTGTGCTGCATTCTCGAGAATGCAGCACAAACAATCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.x-813s1c1
Sequence:CCGGCTGTGAGGAATTATGTCGAAACTCGAGTTTCGACATAATTCCTCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-356s1c1
Sequence:CCGGGATGTGTATTTGGTTATGGAACTCGAGTTCCATAACCAAATACACATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139069.x-1319s1c1
Sequence:CCGGGCTGTCGATGATAGGTTAGAACTCGAGTTCTAACCTATCATCGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-401s1c1
Sequence:CCGGGTTATTCACATGGAGCTGGATCTCGAGATCCAGCTCCATGTGAATAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.x-261s1c1
Sequence:CCGGATCGTGAACTTGTCCTCTTAACTCGAGTTAAGAGGACAAGTTCACGATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.x-997s1c1
Sequence:CCGGGCGTCACCCATACATCACTGTCTCGAGACAGTGATGTATGGGTGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-178s1c1
Sequence:CCGGATTTGATACAGTTCTTGGGATCTCGAGATCCCAAGAACTGTATCAAATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139069.x-812s1c1
Sequence:CCGGACTGTGAGGAATTATGTCGAACTCGAGTTCGACATAATTCCTCACAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-1476s1c1
Sequence:CCGGGATTGCCTGCTTAGATGATAACTCGAGTTATCATCTAAGCAGGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139069.1-869s1c1
Sequence:CCGGCTCTTTCCAGATTGGATATTCCTCGAGGAATATCCAATCTGGAAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195736    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139069.1-1629s1c1
Sequence:CCGGCTGTAACTGTTGAGATGTATGCTCGAGCATACATCTCAACAGTTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-509s1c1
Sequence:CCGGCCTAGCAACATTGTTGTGAAACTCGAGTTTCACAACAATGTTGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-387s1c1
Sequence:CCGGCTAACTTATGTCAGGTTATTCCTCGAGGAATAACCTGACATAAGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-482s1c1
Sequence:CCGGGCTGGTATAATTCATAGAGATCTCGAGATCTCTATGAATTATACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139069.1-878s1c1
Sequence:CCGGGATTGGATATTCCCATCAGAACTCGAGTTCTGATGGGAATATCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_139069.1-1740s1c1
Sequence:CCGGGCTTCTGAAGTTATCTCTTAACTCGAGTTAAGAGATAACTTCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139069.1-1146s1c1
Sequence:CCGGGAAGCAAGAATGGTGTTGTAACTCGAGTTACAACACCATTCTTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002752
VALIDATED
MAPK9 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-356s1c1
Sequence:CCGGGATGTGTATTTGGTTATGGAACTCGAGTTCCATAACCAAATACACATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-160s1c1
Sequence:CCGGAGGGATTGTTTGTGCTGCATTCTCGAGAATGCAGCACAAACAATCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-401s1c1
Sequence:CCGGGTTATTCACATGGAGCTGGATCTCGAGATCCAGCTCCATGTGAATAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-813s1c1
Sequence:CCGGCTGTGAGGAATTATGTCGAAACTCGAGTTTCGACATAATTCCTCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-1567s1c1
Sequence:CCGGGAGCAGTTAGAGTAGGTGAATCTCGAGATTCACCTACTCTAACTGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002752
VALIDATED
MAPK9 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-356s1c1
Sequence:CCGGGATGTGTATTTGGTTATGGAACTCGAGTTCCATAACCAAATACACATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-160s1c1
Sequence:CCGGAGGGATTGTTTGTGCTGCATTCTCGAGAATGCAGCACAAACAATCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-401s1c1
Sequence:CCGGGTTATTCACATGGAGCTGGATCTCGAGATCCAGCTCCATGTGAATAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-813s1c1
Sequence:CCGGCTGTGAGGAATTATGTCGAAACTCGAGTTTCGACATAATTCCTCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-1567s1c1
Sequence:CCGGGAGCAGTTAGAGTAGGTGAATCTCGAGATTCACCTACTCTAACTGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002752
VALIDATED
MAPK9 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-356s1c1
Sequence:CCGGGATGTGTATTTGGTTATGGAACTCGAGTTCCATAACCAAATACACATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-160s1c1
Sequence:CCGGAGGGATTGTTTGTGCTGCATTCTCGAGAATGCAGCACAAACAATCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-401s1c1
Sequence:CCGGGTTATTCACATGGAGCTGGATCTCGAGATCCAGCTCCATGTGAATAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-813s1c1
Sequence:CCGGCTGTGAGGAATTATGTCGAAACTCGAGTTTCGACATAATTCCTCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002752.x-1567s1c1
Sequence:CCGGGAGCAGTTAGAGTAGGTGAATCTCGAGATTCACCTACTCTAACTGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)