EMAIL THIS PAGE TO A FRIEND

MAPKAP1

mitogen-activated protein kinase associated protein 1

192 Gene Product Result for
Synonyms: JC310 MIP1 SIN1 SIN1b SIN1g
Gene ID:
Human(79109) Summary: This gene encodes a protein that is highly similar to the yeast SIN1 protein, a stress-activated protein kinase. Alternatively spliced transcript variants encoding distinct isoforms have been described. Alternate polyadenylation sites as well as alternate 3' UTRs have been identified for transcripts of this gene. [provided by RefSeq, Jul 2008]
Mouse(227743) mitogen-activated protein kinase associated protein 1
Rat(296648) mitogen-activated protein kinase associated protein 1
domestic guinea pig(100730188) mitogen-activated protein kinase associated protein 1
Domestic Rabbit(100338092) mitogen-activated protein kinase associated protein 1
naked mole-rat(101712030) mitogen-activated protein kinase associated protein 1
Zebrafish(492604) mitogen-activated protein kinase associated protein 1
domestic cat(101084749) mitogen-activated protein kinase associated protein 1
cow(533861) mitogen-activated protein kinase associated protein 1
dog(480724) mitogen-activated protein kinase associated protein 1
chicken(395627) mitogen-activated protein kinase associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M3322 Anti-MAPKAP1 (76-90) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
PRS4077 Anti-MAPKAP1 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4079 Anti-MAPKAP1 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4200371 Anti-MAPKAP1 / SIN1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, rat, mouse
immunoprecipitation (IP), western blot pricing
HPA029091 Anti-MAPKAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunofluorescence, immunohistochemistry pricing
HPA029092 Anti-MAPKAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 Antibody Enhanced Validation mouse, human, rat
immunohistochemistry, western blot pricing
PLA0157 Rabbit anti-Sin1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. primate, bovine, rat, mouse, guinea pig, human, turkey, dog, horse, chicken, pig, sheep
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177345 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177345 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177345 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024117 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU075731 MISSION® esiRNA esiRNA targeting mouse Mapkap1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006617 Rosetta Predictions human pricing
NM_001006618 Rosetta Predictions human pricing
NM_001006619 Rosetta Predictions human pricing
NM_001006620 Rosetta Predictions human pricing
NM_001006621 Rosetta Predictions human pricing
NM_024117 Rosetta Predictions human pricing
NM_001011964 Rosetta Predictions rat pricing
XM_575118 Rosetta Predictions rat pricing
NM_177345 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041487 predicted 981
2 SASI_Hs01_00041488 predicted 981
3 SASI_Hs01_00041489 predicted 977
4 SASI_Hs01_00041490 predicted 1023
5 SASI_Hs01_00041491 predicted 1008
6 SASI_Hs01_00041492 predicted 992
7 SASI_Hs01_00041493 predicted 956
8 SASI_Hs01_00041494 predicted 956
9 SASI_Hs01_00041495 predicted 987
10 SASI_Hs02_00305090 predicted 927
11 SASI_Hs01_00041496 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106488 predicted 985
2 SASI_Hs01_00106489 predicted 990
3 SASI_Hs01_00106490 predicted 983
4 SASI_Hs01_00106491 predicted 1019
5 SASI_Hs01_00106492 predicted 1007
6 SASI_Hs01_00106493 predicted 992
7 SASI_Hs01_00106494 predicted 965
8 SASI_Hs01_00106495 predicted 956
9 SASI_Hs01_00106496 predicted 987
10 SASI_Hs02_00305091 predicted 922
11 SASI_Hs01_00106497 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132809 predicted 980
2 SASI_Hs01_00132810 predicted 987
3 SASI_Hs01_00132811 predicted 975
4 SASI_Hs02_00305092 predicted 1017
5 SASI_Hs01_00132812 predicted 1009
6 SASI_Hs01_00132813 predicted 984
7 SASI_Hs01_00132814 predicted 956
8 SASI_Hs01_00132815 predicted 950
9 SASI_Hs01_00132816 predicted 992
10 SASI_Hs01_00132818 predicted 923
11 SASI_Hs01_00132817 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022542 predicted 657
2 SASI_Hs01_00022543 predicted 656
3 SASI_Hs01_00022544 predicted 648
4 SASI_Hs02_00305093 predicted 689
5 SASI_Hs01_00022545 predicted 684
6 SASI_Hs01_00022546 predicted 664
7 SASI_Hs01_00022547 predicted 633
8 SASI_Hs01_00022548 predicted 624
9 SASI_Hs01_00022549 predicted 659
10 SASI_Hs01_00022551 predicted 594
11 SASI_Hs01_00022550 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093268 predicted 566
2 SASI_Hs01_00093269 predicted 563
3 SASI_Hs01_00093270 predicted 562
4 SASI_Hs02_00305094 predicted 599
5 SASI_Hs01_00093271 predicted 590
6 SASI_Hs01_00093272 predicted 568
7 SASI_Hs01_00093273 predicted 538
8 SASI_Hs01_00093274 predicted 533
9 SASI_Hs01_00093275 predicted 577
10 SASI_Hs01_00093277 predicted 506
11 SASI_Hs01_00093276 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080545 predicted 976
2 SASI_Hs01_00080546 predicted 982
3 SASI_Hs01_00080547 predicted 978
4 SASI_Hs01_00080548 predicted 1020
5 SASI_Hs01_00080549 predicted 1009
6 SASI_Hs01_00080550 predicted 990
7 SASI_Hs01_00080551 predicted 959
8 SASI_Hs01_00080552 predicted 951
9 SASI_Hs01_00080553 predicted 990
10 SASI_Hs02_00356611 predicted 923
11 SASI_Hs01_00080554 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035141 predicted 1181
2 SASI_Rn01_00035142 predicted 454
3 SASI_Rn01_00035143 predicted 1201
4 SASI_Rn01_00035144 predicted 1060
5 SASI_Rn01_00035145 predicted 1506
6 SASI_Rn01_00035146 predicted 1336
7 SASI_Rn01_00035147 predicted 1198
8 SASI_Rn01_00035148 predicted 515
9 SASI_Rn01_00035149 predicted 512
10 SASI_Rn01_00035150 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139743 predicted 1205
2 SASI_Rn01_00139744 predicted 480
3 SASI_Rn01_00139745 predicted 1224
4 SASI_Rn01_00139746 predicted 1078
5 SASI_Rn01_00139747 predicted 1525
6 SASI_Rn01_00139748 predicted 1353
7 SASI_Rn01_00139749 predicted 1213
8 SASI_Rn01_00139750 predicted 536
9 SASI_Rn01_00139751 predicted 528
10 SASI_Rn01_00139752 predicted 1887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067214 predicted 1470
2 SASI_Mm01_00067215 predicted 938
3 SASI_Mm01_00067216 predicted 804
4 SASI_Mm01_00067217 predicted 1270
5 SASI_Mm01_00067218 predicted 1108
6 SASI_Mm01_00067219 predicted 1185
7 SASI_Mm01_00067220 predicted 1399
8 SASI_Mm01_00067221 predicted 907
9 SASI_Mm01_00067222 predicted 1315
10 SASI_Mm01_00067223 predicted 1258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177345
VALIDATED
MAPKAP1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase associated protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177345.3-2053s1c1
Sequence:CCGGCCCATATTGAACAGGCAGATTCTCGAGAATCTGCCTGTTCAATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177345.3-247s1c1
Sequence:CCGGCCCAGTCTGTTGATATTACATCTCGAGATGTAATATCAACAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177345.3-803s1c1
Sequence:CCGGGCCCATTCATAAGTTTGGCTTCTCGAGAAGCCAAACTTATGAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177345.3-247s21c1
Sequence:CCGGCCCAGTCTGTTGATATTACATCTCGAGATGTAATATCAACAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177345.3-803s21c1
Sequence:CCGGGCCCATTCATAAGTTTGGCTTCTCGAGAAGCCAAACTTATGAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177345.3-2053s21c1
Sequence:CCGGCCCATATTGAACAGGCAGATTCTCGAGAATCTGCCTGTTCAATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177345.3-1528s21c1
Sequence:CCGGGAGCTGATTATCTTGCTCAAACTCGAGTTTGAGCAAGATAATCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177345
VALIDATED
MAPKAP1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase associated protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177345.3-2053s1c1
Sequence:CCGGCCCATATTGAACAGGCAGATTCTCGAGAATCTGCCTGTTCAATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177345.3-247s1c1
Sequence:CCGGCCCAGTCTGTTGATATTACATCTCGAGATGTAATATCAACAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177345.3-803s1c1
Sequence:CCGGGCCCATTCATAAGTTTGGCTTCTCGAGAAGCCAAACTTATGAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177345.3-247s21c1
Sequence:CCGGCCCAGTCTGTTGATATTACATCTCGAGATGTAATATCAACAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177345.3-803s21c1
Sequence:CCGGGCCCATTCATAAGTTTGGCTTCTCGAGAAGCCAAACTTATGAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177345.3-2053s21c1
Sequence:CCGGCCCATATTGAACAGGCAGATTCTCGAGAATCTGCCTGTTCAATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177345.3-1528s21c1
Sequence:CCGGGAGCTGATTATCTTGCTCAAACTCGAGTTTGAGCAAGATAATCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177345
VALIDATED
MAPKAP1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase associated protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177345.3-2053s1c1
Sequence:CCGGCCCATATTGAACAGGCAGATTCTCGAGAATCTGCCTGTTCAATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177345.3-247s1c1
Sequence:CCGGCCCAGTCTGTTGATATTACATCTCGAGATGTAATATCAACAGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177345.3-803s1c1
Sequence:CCGGGCCCATTCATAAGTTTGGCTTCTCGAGAAGCCAAACTTATGAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177345.3-247s21c1
Sequence:CCGGCCCAGTCTGTTGATATTACATCTCGAGATGTAATATCAACAGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177345.3-803s21c1
Sequence:CCGGGCCCATTCATAAGTTTGGCTTCTCGAGAAGCCAAACTTATGAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177345.3-2053s21c1
Sequence:CCGGCCCATATTGAACAGGCAGATTCTCGAGAATCTGCCTGTTCAATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177345.3-1528s21c1
Sequence:CCGGGAGCTGATTATCTTGCTCAAACTCGAGTTTGAGCAAGATAATCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024117
VALIDATED
MAPKAP1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase associated protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-2035s1c1
Sequence:CCGGAGCCACCTTCAATGCCTGCCACTCGAGTGGCAGGCATTGAAGGTGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-1308s1c1
Sequence:CCGGGCCACAGTACAGGATATGCTTCTCGAGAAGCATATCCTGTACTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-526s1c1
Sequence:CCGGGTTGGGACTTTGGTATTAGAACTCGAGTTCTAATACCAAAGTCCCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-1566s1c1
Sequence:CCGGCTAAGCAATCACGACTATAAACTCGAGTTTATAGTCGTGATTGCTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-508s1c1
Sequence:CCGGCAGTCGATATTACCTCAAGTTCTCGAGAACTTGAGGTAATATCGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-1339s21c1
Sequence:CCGGGCCACAGTACAGGATATGCTTCTCGAGAAGCATATCCTGTACTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-557s21c1
Sequence:CCGGGTTGGGACTTTGGTATTAGAACTCGAGTTCTAATACCAAAGTCCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-539s21c1
Sequence:CCGGCAGTCGATATTACCTCAAGTTCTCGAGAACTTGAGGTAATATCGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-2066s21c1
Sequence:CCGGAGCCACCTTCAATGCCTGCCACTCGAGTGGCAGGCATTGAAGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-1597s21c1
Sequence:CCGGCTAAGCAATCACGACTATAAACTCGAGTTTATAGTCGTGATTGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024117
VALIDATED
MAPKAP1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase associated protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-2035s1c1
Sequence:CCGGAGCCACCTTCAATGCCTGCCACTCGAGTGGCAGGCATTGAAGGTGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-1308s1c1
Sequence:CCGGGCCACAGTACAGGATATGCTTCTCGAGAAGCATATCCTGTACTGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-526s1c1
Sequence:CCGGGTTGGGACTTTGGTATTAGAACTCGAGTTCTAATACCAAAGTCCCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-1566s1c1
Sequence:CCGGCTAAGCAATCACGACTATAAACTCGAGTTTATAGTCGTGATTGCTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-508s1c1
Sequence:CCGGCAGTCGATATTACCTCAAGTTCTCGAGAACTTGAGGTAATATCGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-1339s21c1
Sequence:CCGGGCCACAGTACAGGATATGCTTCTCGAGAAGCATATCCTGTACTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-557s21c1
Sequence:CCGGGTTGGGACTTTGGTATTAGAACTCGAGTTCTAATACCAAAGTCCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-539s21c1
Sequence:CCGGCAGTCGATATTACCTCAAGTTCTCGAGAACTTGAGGTAATATCGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-2066s21c1
Sequence:CCGGAGCCACCTTCAATGCCTGCCACTCGAGTGGCAGGCATTGAAGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-1597s21c1
Sequence:CCGGCTAAGCAATCACGACTATAAACTCGAGTTTATAGTCGTGATTGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024117
VALIDATED
MAPKAP1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase associated protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-2035s1c1
Sequence:CCGGAGCCACCTTCAATGCCTGCCACTCGAGTGGCAGGCATTGAAGGTGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-1308s1c1
Sequence:CCGGGCCACAGTACAGGATATGCTTCTCGAGAAGCATATCCTGTACTGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-526s1c1
Sequence:CCGGGTTGGGACTTTGGTATTAGAACTCGAGTTCTAATACCAAAGTCCCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-1566s1c1
Sequence:CCGGCTAAGCAATCACGACTATAAACTCGAGTTTATAGTCGTGATTGCTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024117.x-508s1c1
Sequence:CCGGCAGTCGATATTACCTCAAGTTCTCGAGAACTTGAGGTAATATCGACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-1339s21c1
Sequence:CCGGGCCACAGTACAGGATATGCTTCTCGAGAAGCATATCCTGTACTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-557s21c1
Sequence:CCGGGTTGGGACTTTGGTATTAGAACTCGAGTTCTAATACCAAAGTCCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-539s21c1
Sequence:CCGGCAGTCGATATTACCTCAAGTTCTCGAGAACTTGAGGTAATATCGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-2066s21c1
Sequence:CCGGAGCCACCTTCAATGCCTGCCACTCGAGTGGCAGGCATTGAAGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_024117.3-1597s21c1
Sequence:CCGGCTAAGCAATCACGACTATAAACTCGAGTTTATAGTCGTGATTGCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)