EMAIL THIS PAGE TO A FRIEND

MAPKAPK2

mitogen-activated protein kinase-activated protein kinase 2

203 Gene Product Result for
Synonyms: MAPKAP-K2 MK-2 MK2
UniProtKB ID: P49137, Q5SY30, Q5SY41, Q8IYD6
Gene ID:
Human(9261) Summary: This gene encodes a member of the Ser/Thr protein kinase family. This kinase is regulated through direct phosphorylation by p38 MAP kinase. In conjunction with p38 MAP kinase, this kinase is known to be involved in many cellular processes including stress and inflammatory responses, nuclear export, gene expression regulation and cell proliferation. Heat shock protein HSP27 was shown to be one of the substrates of this kinase in vivo. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17164) MAP kinase-activated protein kinase 2
Rat(289014) mitogen-activated protein kinase-activated protein kinase 2
chicken(419847) mitogen-activated protein kinase-activated protein kinase 2
cow(788091) mitogen-activated protein kinase-activated protein kinase 2
dog(490263) mitogen-activated protein kinase-activated protein kinase 2
domestic cat(101090833) mitogen-activated protein kinase-activated protein kinase 2
naked mole-rat(101708612) mitogen-activated protein kinase-activated protein kinase 2
Domestic Rabbit(100009438) mitogen-activated protein kinase-activated protein kinase 2
domestic guinea pig(100715906) mitogen-activated protein kinase-activated protein kinase 2
sheep(101118118) mitogen-activated protein kinase-activated protein kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M3550 Anti-MAP Kinase Activated Protein Kinase-2 (MAPKAPK-2) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, bovine, human
microarray, western blot pricing
M3447 Anti-MAPKAPK2 (1-14) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300553 Anti-MAPKAPK2 (Ab-334) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, western blot pricing
SAB1412290 ANTI-MAPKAPK2 antibody produced in mouse clone 2A10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412291 ANTI-MAPKAPK2 antibody produced in mouse clone 1F9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1412292 ANTI-MAPKAPK2 antibody produced in mouse clone 3A7, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, western blot pricing
AV8025 Anti-MAPKAPK2 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human
immunohistochemistry, western blot pricing
SAB4503602 Anti-MAPKAPK2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4503603 Anti-MAPKAPK2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503604 Anti-MAPKAPK2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
HPA045556 Anti-MAPKAPK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA063708 Anti-MAPKAPK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing
HPA064435 Anti-MAPKAPK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing
SAB1304717 ANTI-MOUSE MAPKAPK2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504036 Anti-phospho-MAPKAPK-2 (pThr222) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504709 Anti-phospho-MAPKAPK2 (pSer272) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301363 Anti-phospho-MAPKAPK2 (pSer272) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4300241 Anti-phospho-MAPKAPK2 (pThr334) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503769 Anti-phospho-MAPKAPK2 (pThr334) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
WH0009261M1 Monoclonal Anti-MAPKAPK2 antibody produced in mouse clone 2B3, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing
SAB1404696 Monoclonal Anti-MAPKAPK2 antibody produced in mouse clone 3B8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A8626 Adenine ≥99% human, mouse, rat pricing
A2786 Adenine suitable for cell culture, BioReagent human, mouse, rat pricing
A5665 Adenine BioReagent, plant cell culture tested, ≥99% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032960 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004759 Rosetta Predictions human pricing
NM_032960 Rosetta Predictions human pricing
NM_178102 Rosetta Predictions rat pricing
XM_579712 Rosetta Predictions rat pricing
NM_008551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077768 predicted 763
2 SASI_Hs01_00077769 predicted 802
3 SASI_Hs01_00077770 predicted 737
4 SASI_Hs01_00077771 predicted 772
5 SASI_Hs01_00077772 predicted 802
6 SASI_Hs01_00077773 predicted 767
7 SASI_Hs01_00077774 predicted 675
8 SASI_Hs01_00077775 predicted 932
9 SASI_Hs01_00077776 predicted 1142
10 SASI_Hs01_00077777 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052808 predicted 1698
2 SASI_Hs01_00052809 predicted 758
3 SASI_Hs01_00052810 predicted 796
4 SASI_Hs01_00052812 predicted 738
5 SASI_Hs01_00052813 predicted 775
6 SASI_Hs01_00052814 predicted 807
7 SASI_Hs01_00052815 predicted 684
8 SASI_Hs01_00052816 predicted 1555
9 SASI_Hs01_00052817 predicted 724
10 SASI_Hs02_00360581 predicted 1596
11 SASI_Hs01_00052811 predicted 1748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108577 predicted 1390
2 SASI_Rn01_00108578 predicted 1351
3 SASI_Rn01_00108579 predicted 934
4 SASI_Rn02_00269631 predicted 829
5 SASI_Rn01_00108580 predicted 1194
6 SASI_Rn01_00108581 predicted 907
7 SASI_Rn01_00108583 predicted 1085
8 SASI_Rn01_00108584 predicted 921
9 SASI_Rn01_00108585 predicted 1078
10 SASI_Rn01_00108586 predicted 1414
11 SASI_Rn01_00108582 predicted 1495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129522 predicted 1035
2 SASI_Rn01_00129523 predicted 1001
3 SASI_Rn01_00129524 predicted 1223
4 SASI_Rn01_00129525 predicted 1139
5 SASI_Rn01_00129526 predicted 1074
6 SASI_Rn01_00129527 predicted 986
7 SASI_Rn01_00129528 predicted 1116
8 SASI_Rn01_00129529 predicted 1452
9 SASI_Rn01_00129530 predicted 1453
10 SASI_Rn01_00129531 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045592 predicted 913
2 SASI_Mm01_00045593 predicted 789
3 SASI_Mm01_00045594 predicted 1105
4 SASI_Mm02_00314144 predicted 547
5 SASI_Mm01_00045596 predicted 316
6 SASI_Mm01_00045597 predicted 654
7 SASI_Mm01_00045598 predicted 622
8 SASI_Mm01_00045599 predicted 802
9 SASI_Mm01_00045600 predicted 871
10 SASI_Mm01_00045601 predicted 244
11 SASI_Mm01_00045595 predicted 1208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008551
VALIDATED
MAPKAPK2 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase-activated protein kinase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-398s21c1
Sequence:CCGGTCGATGGTGGAGAGCTCTTTACTCGAGTAAAGAGCTCTCCACCATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-503s21c1
Sequence:CCGGACCTGCACTCGATCAACATTGCTCGAGCAATGTTGATCGAGTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-1840s21c1
Sequence:CCGGTAGATCCAGAGCCAGGTAATTCTCGAGAATTACCTGGCTCTGGATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-793s21c1
Sequence:CCGGCCGGGCATGAAGACTCGTATTCTCGAGAATACGAGTCTTCATGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-633s21c1
Sequence:CCGGTTTGACCACTCCGTGTTATACCTCGAGGTATAACACGGAGTGGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008551.1-340s1c1
Sequence:CCGGGATGTCTATGAGAACCTGTATCTCGAGATACAGGTTCTCATAGACATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008551.1-642s1c1
Sequence:CCGGTCCGTGTTATACACCATACTACTCGAGTAGTATGGTGTATAACACGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008551.1-909s1c1
Sequence:CCGGCCAGAGAATGACCATCACAGACTCGAGTCTGTGATGGTCATTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008551.1-221s1c1
Sequence:CCGGTCGACAAGAGAACCCAGCAAACTCGAGTTTGCTGGGTTCTCTTGTCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008551.1-793s1c1
Sequence:CCGGCCGGGCATGAAGACTCGTATTCTCGAGAATACGAGTCTTCATGCCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008551
VALIDATED
MAPKAPK2 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase-activated protein kinase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-398s21c1
Sequence:CCGGTCGATGGTGGAGAGCTCTTTACTCGAGTAAAGAGCTCTCCACCATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-503s21c1
Sequence:CCGGACCTGCACTCGATCAACATTGCTCGAGCAATGTTGATCGAGTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-1840s21c1
Sequence:CCGGTAGATCCAGAGCCAGGTAATTCTCGAGAATTACCTGGCTCTGGATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-793s21c1
Sequence:CCGGCCGGGCATGAAGACTCGTATTCTCGAGAATACGAGTCTTCATGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-633s21c1
Sequence:CCGGTTTGACCACTCCGTGTTATACCTCGAGGTATAACACGGAGTGGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008551.1-340s1c1
Sequence:CCGGGATGTCTATGAGAACCTGTATCTCGAGATACAGGTTCTCATAGACATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008551.1-642s1c1
Sequence:CCGGTCCGTGTTATACACCATACTACTCGAGTAGTATGGTGTATAACACGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008551.1-909s1c1
Sequence:CCGGCCAGAGAATGACCATCACAGACTCGAGTCTGTGATGGTCATTCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008551.1-221s1c1
Sequence:CCGGTCGACAAGAGAACCCAGCAAACTCGAGTTTGCTGGGTTCTCTTGTCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008551.1-793s1c1
Sequence:CCGGCCGGGCATGAAGACTCGTATTCTCGAGAATACGAGTCTTCATGCCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008551
VALIDATED
MAPKAPK2 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase-activated protein kinase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-398s21c1
Sequence:CCGGTCGATGGTGGAGAGCTCTTTACTCGAGTAAAGAGCTCTCCACCATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-503s21c1
Sequence:CCGGACCTGCACTCGATCAACATTGCTCGAGCAATGTTGATCGAGTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-1840s21c1
Sequence:CCGGTAGATCCAGAGCCAGGTAATTCTCGAGAATTACCTGGCTCTGGATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-793s21c1
Sequence:CCGGCCGGGCATGAAGACTCGTATTCTCGAGAATACGAGTCTTCATGCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008551.1-633s21c1
Sequence:CCGGTTTGACCACTCCGTGTTATACCTCGAGGTATAACACGGAGTGGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008551.1-340s1c1
Sequence:CCGGGATGTCTATGAGAACCTGTATCTCGAGATACAGGTTCTCATAGACATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008551.1-642s1c1
Sequence:CCGGTCCGTGTTATACACCATACTACTCGAGTAGTATGGTGTATAACACGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008551.1-909s1c1
Sequence:CCGGCCAGAGAATGACCATCACAGACTCGAGTCTGTGATGGTCATTCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008551.1-221s1c1
Sequence:CCGGTCGACAAGAGAACCCAGCAAACTCGAGTTTGCTGGGTTCTCTTGTCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008551.1-793s1c1
Sequence:CCGGCCGGGCATGAAGACTCGTATTCTCGAGAATACGAGTCTTCATGCCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032960
VALIDATED
MAPKAPK2 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase-activated protein kinase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-645s1c1
Sequence:CCGGTCGTGGATGTGTACGAGAATCCTCGAGGATTCTCGTACACATCCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-804s1c1
Sequence:CCGGCCATCCAGTATCTGCATTCAACTCGAGTTGAATGCAGATACTGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-1236s1c1
Sequence:CCGGCCGAGTTTATGAACCACCCTTCTCGAGAAGGGTGGTTCATAAACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-940s1c1
Sequence:CCGGCTCTTTGACCACTCCTTGTTACTCGAGTAACAAGGAGTGGTCAAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-1382s1c1
Sequence:CCGGGACTACGAGCAGATCAAGATACTCGAGTATCTTGATCTGCTCGTAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-2982s1c1
Sequence:CCGGCCAGCACTCGATTGTTGTAAACTCGAGTTTACAACAATCGAGTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-763s1c1
Sequence:CCGGAGAAAGAGAAGCATCCGAAATCTCGAGATTTCGGATGCTTCTCTTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032960.2-1839s1c1
Sequence:CCGGTGGTTTGTTAGAGGGTATTTGCTCGAGCAAATACCCTCTAACAAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-689s1c1
Sequence:CCGGCTGATTGTCATGGAATGTTTGCTCGAGCAAACATTCCATGACAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032960
VALIDATED
MAPKAPK2 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase-activated protein kinase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-645s1c1
Sequence:CCGGTCGTGGATGTGTACGAGAATCCTCGAGGATTCTCGTACACATCCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-804s1c1
Sequence:CCGGCCATCCAGTATCTGCATTCAACTCGAGTTGAATGCAGATACTGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-1236s1c1
Sequence:CCGGCCGAGTTTATGAACCACCCTTCTCGAGAAGGGTGGTTCATAAACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-940s1c1
Sequence:CCGGCTCTTTGACCACTCCTTGTTACTCGAGTAACAAGGAGTGGTCAAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-1382s1c1
Sequence:CCGGGACTACGAGCAGATCAAGATACTCGAGTATCTTGATCTGCTCGTAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-2982s1c1
Sequence:CCGGCCAGCACTCGATTGTTGTAAACTCGAGTTTACAACAATCGAGTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-763s1c1
Sequence:CCGGAGAAAGAGAAGCATCCGAAATCTCGAGATTTCGGATGCTTCTCTTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032960.2-1839s1c1
Sequence:CCGGTGGTTTGTTAGAGGGTATTTGCTCGAGCAAATACCCTCTAACAAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-689s1c1
Sequence:CCGGCTGATTGTCATGGAATGTTTGCTCGAGCAAACATTCCATGACAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032960
VALIDATED
MAPKAPK2 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase-activated protein kinase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-645s1c1
Sequence:CCGGTCGTGGATGTGTACGAGAATCCTCGAGGATTCTCGTACACATCCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-804s1c1
Sequence:CCGGCCATCCAGTATCTGCATTCAACTCGAGTTGAATGCAGATACTGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-1236s1c1
Sequence:CCGGCCGAGTTTATGAACCACCCTTCTCGAGAAGGGTGGTTCATAAACTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-940s1c1
Sequence:CCGGCTCTTTGACCACTCCTTGTTACTCGAGTAACAAGGAGTGGTCAAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-1382s1c1
Sequence:CCGGGACTACGAGCAGATCAAGATACTCGAGTATCTTGATCTGCTCGTAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-2982s1c1
Sequence:CCGGCCAGCACTCGATTGTTGTAAACTCGAGTTTACAACAATCGAGTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032960.x-763s1c1
Sequence:CCGGAGAAAGAGAAGCATCCGAAATCTCGAGATTTCGGATGCTTCTCTTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032960.2-1839s1c1
Sequence:CCGGTGGTTTGTTAGAGGGTATTTGCTCGAGCAAATACCCTCTAACAAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032960.2-689s1c1
Sequence:CCGGCTGATTGTCATGGAATGTTTGCTCGAGCAAACATTCCATGACAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)