EMAIL THIS PAGE TO A FRIEND

MAPKAPK3

mitogen-activated protein kinase-activated protein kinase 3

184 Gene Product Result for
Synonyms: 3PK MAPKAP-K3 MAPKAP3 MAPKAPK-3 MK-3
UniProtKB ID: Q16644, B5BU67
Gene ID:
Human(7867) Summary: This gene encodes a member of the Ser/Thr protein kinase family. This kinase functions as a mitogen-activated protein kinase (MAP kinase)- activated protein kinase. MAP kinases are also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This kinase was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
Mouse(102626) mitogen-activated protein kinase-activated protein kinase 3
Rat(315994) mitogen-activated protein kinase-activated protein kinase 3
Zebrafish(790934) mitogen-activated protein kinase-activated protein kinase 3
chicken(415917) mitogen-activated protein kinase-activated protein kinase 3
dog(484756) mitogen-activated protein kinase-activated protein kinase 3
cow(615215) mitogen-activated protein kinase-activated protein kinase 3
domestic cat(101096794) mitogen-activated protein kinase-activated protein kinase 3
sheep(101118996) mitogen-activated protein kinase-activated protein kinase 3
domestic guinea pig(100719631) mitogen-activated protein kinase-activated protein kinase 3
Domestic Rabbit(100342292) mitogen-activated protein kinase-activated protein kinase 3
naked mole-rat(101717099) mitogen-activated protein kinase-activated protein kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503135 Anti-MAPK3, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
M3697 Anti-MAPKAPK3 (31-43) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
M3822 Anti-MAPKAPK3 (321-333) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW22349A Anti-MAPKAPK3 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
GW22349B Anti-MAPKAPK3 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1412417 ANTI-MAPKAPK3 antibody produced in mouse clone 1C3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412418 ANTI-MAPKAPK3 antibody produced in mouse clone 4B11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA058275 Anti-MAPKAPK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1302238 ANTI-MOUSE MAPKAPK3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
WH0007867M1 Monoclonal Anti-MAPKAPK3 antibody produced in mouse clone 3F4, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunoprecipitation (IP), western blot pricing
SAB1404561 Monoclonal Anti-MAPKAPK3, (C-terminal) antibody produced in mouse clone 2B5, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004635 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004635 Rosetta Predictions human pricing
NM_001012127 Rosetta Predictions rat pricing
XM_576467 Rosetta Predictions rat pricing
NM_178907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051108 predicted 639
2 SASI_Hs01_00051109 predicted 568
3 SASI_Hs01_00051110 predicted 1284
4 SASI_Hs01_00051111 predicted 477
5 SASI_Hs01_00051112 predicted 1120
6 SASI_Hs01_00051113 predicted 542
7 SASI_Hs01_00051114 predicted 1173
8 SASI_Hs01_00051115 predicted 708
9 SASI_Hs01_00051116 predicted 564
10 SASI_Hs01_00051117 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087815 predicted 829
2 SASI_Rn01_00087816 predicted 681
3 SASI_Rn01_00087817 predicted 887
4 SASI_Rn01_00087818 predicted 897
5 SASI_Rn02_00200293 predicted 1168
6 SASI_Rn01_00087820 predicted 1182
7 SASI_Rn01_00087821 predicted 388
8 SASI_Rn01_00087822 predicted 1063
9 SASI_Rn01_00087823 predicted 443
10 SASI_Rn01_00087824 predicted 1075
11 SASI_Rn01_00087819 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154613 predicted 954
2 SASI_Rn01_00154614 predicted 808
3 SASI_Rn01_00154615 predicted 1009
4 SASI_Rn01_00154616 predicted 1019
5 SASI_Rn01_00154617 predicted 833
6 SASI_Rn01_00154618 predicted 1298
7 SASI_Rn01_00154619 predicted 507
8 SASI_Rn01_00154620 predicted 1194
9 SASI_Rn01_00154621 predicted 561
10 SASI_Rn01_00154622 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025032 predicted 1476
2 SASI_Mm01_00025033 predicted 944
3 SASI_Mm01_00025034 predicted 1027
4 SASI_Mm01_00025035 predicted 950
5 SASI_Mm01_00025036 predicted 1284
6 SASI_Mm01_00025037 predicted 1428
7 SASI_Mm01_00025039 predicted 1307
8 SASI_Mm01_00025040 predicted 509
9 SASI_Mm02_00349506 predicted 1173
10 SASI_Mm02_00349507 predicted 1660
11 SASI_Mm01_00025038 predicted 1296
12 SASI_Mm01_00025041 predicted 847
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004635
VALIDATED
MAPKAPK3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase-activated protein kinase 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-1502s1c1
Sequence:CCGGGCAGCACCTTTAGCTAGGTTGCTCGAGCAACCTAGCTAAAGGTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-320s1c1
Sequence:CCGGGCCCTGAAGCTCCTGTATGACCTCGAGGTCATACAGGAGCTTCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-2179s1c1
Sequence:CCGGCATTAACCTGAGGTCTCTTTCCTCGAGGAAAGAGACCTCAGGTTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-1983s1c1
Sequence:CCGGGAACTTAAGGTGGGAGATATTCTCGAGAATATCTCCCACCTTAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-208s1c1
Sequence:CCGGGCCCAAGAAGTACGCAGTGACCTCGAGGTCACTGCGTACTTCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-1291s1c1
Sequence:CCGGGCCTGCATAACAGACTGAAATCTCGAGATTTCAGTCTGTTATGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004635.3-1189s1c1
Sequence:CCGGGCTCCTCAACAAGAGGAGAAACTCGAGTTTCTCCTCTTGTTGAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-713s1c1
Sequence:CCGGCCCTGCTATACTCCCTATTATCTCGAGATAATAGGGAGTATAGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-451s1c1
Sequence:CCGGCCTCATCATCATGGAATGCATCTCGAGATGCATTCCATGATGATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004635.3-2179s21c1
Sequence:CCGGCATTAACCTGAGGTCTCTTTCCTCGAGGAAAGAGACCTCAGGTTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004635.3-1291s21c1
Sequence:CCGGGCCTGCATAACAGACTGAAATCTCGAGATTTCAGTCTGTTATGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004635.3-208s21c1
Sequence:CCGGGCCCAAGAAGTACGCAGTGACCTCGAGGTCACTGCGTACTTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004635.3-1502s21c1
Sequence:CCGGGCAGCACCTTTAGCTAGGTTGCTCGAGCAACCTAGCTAAAGGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004635.3-713s21c1
Sequence:CCGGCCCTGCTATACTCCCTATTATCTCGAGATAATAGGGAGTATAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004635
VALIDATED
MAPKAPK3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase-activated protein kinase 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-1502s1c1
Sequence:CCGGGCAGCACCTTTAGCTAGGTTGCTCGAGCAACCTAGCTAAAGGTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-320s1c1
Sequence:CCGGGCCCTGAAGCTCCTGTATGACCTCGAGGTCATACAGGAGCTTCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-2179s1c1
Sequence:CCGGCATTAACCTGAGGTCTCTTTCCTCGAGGAAAGAGACCTCAGGTTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-1983s1c1
Sequence:CCGGGAACTTAAGGTGGGAGATATTCTCGAGAATATCTCCCACCTTAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-208s1c1
Sequence:CCGGGCCCAAGAAGTACGCAGTGACCTCGAGGTCACTGCGTACTTCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-1291s1c1
Sequence:CCGGGCCTGCATAACAGACTGAAATCTCGAGATTTCAGTCTGTTATGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004635.3-1189s1c1
Sequence:CCGGGCTCCTCAACAAGAGGAGAAACTCGAGTTTCTCCTCTTGTTGAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-713s1c1
Sequence:CCGGCCCTGCTATACTCCCTATTATCTCGAGATAATAGGGAGTATAGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-451s1c1
Sequence:CCGGCCTCATCATCATGGAATGCATCTCGAGATGCATTCCATGATGATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004635.3-2179s21c1
Sequence:CCGGCATTAACCTGAGGTCTCTTTCCTCGAGGAAAGAGACCTCAGGTTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004635.3-1291s21c1
Sequence:CCGGGCCTGCATAACAGACTGAAATCTCGAGATTTCAGTCTGTTATGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004635.3-208s21c1
Sequence:CCGGGCCCAAGAAGTACGCAGTGACCTCGAGGTCACTGCGTACTTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004635.3-1502s21c1
Sequence:CCGGGCAGCACCTTTAGCTAGGTTGCTCGAGCAACCTAGCTAAAGGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004635.3-713s21c1
Sequence:CCGGCCCTGCTATACTCCCTATTATCTCGAGATAATAGGGAGTATAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004635
VALIDATED
MAPKAPK3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase-activated protein kinase 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-1502s1c1
Sequence:CCGGGCAGCACCTTTAGCTAGGTTGCTCGAGCAACCTAGCTAAAGGTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-320s1c1
Sequence:CCGGGCCCTGAAGCTCCTGTATGACCTCGAGGTCATACAGGAGCTTCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-2179s1c1
Sequence:CCGGCATTAACCTGAGGTCTCTTTCCTCGAGGAAAGAGACCTCAGGTTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-1983s1c1
Sequence:CCGGGAACTTAAGGTGGGAGATATTCTCGAGAATATCTCCCACCTTAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-208s1c1
Sequence:CCGGGCCCAAGAAGTACGCAGTGACCTCGAGGTCACTGCGTACTTCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-1291s1c1
Sequence:CCGGGCCTGCATAACAGACTGAAATCTCGAGATTTCAGTCTGTTATGCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004635.3-1189s1c1
Sequence:CCGGGCTCCTCAACAAGAGGAGAAACTCGAGTTTCTCCTCTTGTTGAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-713s1c1
Sequence:CCGGCCCTGCTATACTCCCTATTATCTCGAGATAATAGGGAGTATAGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004635.3-451s1c1
Sequence:CCGGCCTCATCATCATGGAATGCATCTCGAGATGCATTCCATGATGATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004635.3-2179s21c1
Sequence:CCGGCATTAACCTGAGGTCTCTTTCCTCGAGGAAAGAGACCTCAGGTTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004635.3-1291s21c1
Sequence:CCGGGCCTGCATAACAGACTGAAATCTCGAGATTTCAGTCTGTTATGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004635.3-208s21c1
Sequence:CCGGGCCCAAGAAGTACGCAGTGACCTCGAGGTCACTGCGTACTTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004635.3-1502s21c1
Sequence:CCGGGCAGCACCTTTAGCTAGGTTGCTCGAGCAACCTAGCTAAAGGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004635.3-713s21c1
Sequence:CCGGCCCTGCTATACTCCCTATTATCTCGAGATAATAGGGAGTATAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178907
VALIDATED
MAPKAPK3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase-activated protein kinase 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1287s1c1
Sequence:CCGGGCTAACGATCATGCAGTTTATCTCGAGATAAACTGCATGATCGTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-711s1c1
Sequence:CCGGCCTGGACGTGTATGAGAATATCTCGAGATATTCTCATACACGTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-952s1c1
Sequence:CCGGGCTGTACTTAAACTCACCGATCTCGAGATCGGTGAGTTTAAGTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-841s1c1
Sequence:CCGGGCAGAGATAATGCGGGACATTCTCGAGAATGTCCCGCATTATCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1539s1c1
Sequence:CCGGACAAGGATGCAACAACCAGTACTCGAGTACTGGTTGTTGCATCCTTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178907.1-501s1c1
Sequence:CCGGGCGACGGGAACCCAAGAAGTACTCGAGTACTTCTTGGGTTCCCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-749s1c1
Sequence:CCGGGTCTCCTCATCGTCATGGAATCTCGAGATTCCATGACGATGAGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-576s1c1
Sequence:CCGGCGGCAAGGTACTGGAGTGCTACTCGAGTAGCACTCCAGTACCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1314s1c1
Sequence:CCGGTCCTTGGATCAATCAATCCATCTCGAGATGGATTGATTGATCCAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1213s1c1
Sequence:CCGGCCTGAATGGTTAGATGTCTCTCTCGAGAGAGACATCTAACCATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178907.3-1659s21c1
Sequence:CCGGGTTGTCTTATGTGTCACATTGCTCGAGCAATGTGACACATAAGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178907.3-1430s21c1
Sequence:CCGGCCACTATGCGGGTAGACTATGCTCGAGCATAGTCTACCCGCATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178907.3-1580s21c1
Sequence:CCGGGCCAGGCTGACAGACTGTAATCTCGAGATTACAGTCTGTCAGCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178907
VALIDATED
MAPKAPK3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase-activated protein kinase 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1287s1c1
Sequence:CCGGGCTAACGATCATGCAGTTTATCTCGAGATAAACTGCATGATCGTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-711s1c1
Sequence:CCGGCCTGGACGTGTATGAGAATATCTCGAGATATTCTCATACACGTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-952s1c1
Sequence:CCGGGCTGTACTTAAACTCACCGATCTCGAGATCGGTGAGTTTAAGTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-841s1c1
Sequence:CCGGGCAGAGATAATGCGGGACATTCTCGAGAATGTCCCGCATTATCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1539s1c1
Sequence:CCGGACAAGGATGCAACAACCAGTACTCGAGTACTGGTTGTTGCATCCTTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178907.1-501s1c1
Sequence:CCGGGCGACGGGAACCCAAGAAGTACTCGAGTACTTCTTGGGTTCCCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-749s1c1
Sequence:CCGGGTCTCCTCATCGTCATGGAATCTCGAGATTCCATGACGATGAGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-576s1c1
Sequence:CCGGCGGCAAGGTACTGGAGTGCTACTCGAGTAGCACTCCAGTACCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1314s1c1
Sequence:CCGGTCCTTGGATCAATCAATCCATCTCGAGATGGATTGATTGATCCAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1213s1c1
Sequence:CCGGCCTGAATGGTTAGATGTCTCTCTCGAGAGAGACATCTAACCATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178907.3-1659s21c1
Sequence:CCGGGTTGTCTTATGTGTCACATTGCTCGAGCAATGTGACACATAAGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178907.3-1430s21c1
Sequence:CCGGCCACTATGCGGGTAGACTATGCTCGAGCATAGTCTACCCGCATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178907.3-1580s21c1
Sequence:CCGGGCCAGGCTGACAGACTGTAATCTCGAGATTACAGTCTGTCAGCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178907
VALIDATED
MAPKAPK3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase-activated protein kinase 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1287s1c1
Sequence:CCGGGCTAACGATCATGCAGTTTATCTCGAGATAAACTGCATGATCGTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-711s1c1
Sequence:CCGGCCTGGACGTGTATGAGAATATCTCGAGATATTCTCATACACGTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-952s1c1
Sequence:CCGGGCTGTACTTAAACTCACCGATCTCGAGATCGGTGAGTTTAAGTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-841s1c1
Sequence:CCGGGCAGAGATAATGCGGGACATTCTCGAGAATGTCCCGCATTATCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1539s1c1
Sequence:CCGGACAAGGATGCAACAACCAGTACTCGAGTACTGGTTGTTGCATCCTTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178907.1-501s1c1
Sequence:CCGGGCGACGGGAACCCAAGAAGTACTCGAGTACTTCTTGGGTTCCCGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-749s1c1
Sequence:CCGGGTCTCCTCATCGTCATGGAATCTCGAGATTCCATGACGATGAGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-576s1c1
Sequence:CCGGCGGCAAGGTACTGGAGTGCTACTCGAGTAGCACTCCAGTACCTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1314s1c1
Sequence:CCGGTCCTTGGATCAATCAATCCATCTCGAGATGGATTGATTGATCCAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178907.1-1213s1c1
Sequence:CCGGCCTGAATGGTTAGATGTCTCTCTCGAGAGAGACATCTAACCATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178907.3-1659s21c1
Sequence:CCGGGTTGTCTTATGTGTCACATTGCTCGAGCAATGTGACACATAAGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178907.3-1430s21c1
Sequence:CCGGCCACTATGCGGGTAGACTATGCTCGAGCATAGTCTACCCGCATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178907.3-1580s21c1
Sequence:CCGGGCCAGGCTGACAGACTGTAATCTCGAGATTACAGTCTGTCAGCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)