EMAIL THIS PAGE TO A FRIEND

MAPKAPK5-AS1

MAPKAPK5 antisense RNA 1

2 Gene Product Result for
Synonyms: C12orf47
Species: Human MAPKAPK5-AS1(51275)
UniProtKB ID: Q8N8E1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016534 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016534
MAPKAPK5-AS1 MISSION shRNA Bacterial Glycerol Stock
MAPKAPK5 antisense RNA 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1349s1c1
Sequence:CCGGCGATAACCTATCAAAGGGCTTCTCGAGAAGCCCTTTGATAGGTTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1740s1c1
Sequence:CCGGCCTGAAGGATTAGATGTGGAACTCGAGTTCCACATCTAATCCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1295s1c1
Sequence:CCGGCGAGAAGTGGTCAAGCTAGAACTCGAGTTCTAGCTTGACCACTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1826s1c1
Sequence:CCGGGATGCCATTGAGTGAGTGAAACTCGAGTTTCACTCACTCAATGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1187s1c1
Sequence:CCGGCGTCTTTACAAGGTAGCCGTTCTCGAGAACGGCTACCTTGTAAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1158s1c1
Sequence:CCGGGTGGAGTTATTTCCTGCATTTCTCGAGAAATGCAGGAAATAACTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1646s1c1
Sequence:CCGGCCTCCCAAAGTACTGGGATTACTCGAGTAATCCCAGTACTTTGGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1145s1c1
Sequence:CCGGGCATTAACCTTACGTGGAGTTCTCGAGAACTCCACGTAAGGTTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016534
MAPKAPK5-AS1 MISSION shRNA shRNA Plasmid DNA
MAPKAPK5 antisense RNA 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1349s1c1
Sequence:CCGGCGATAACCTATCAAAGGGCTTCTCGAGAAGCCCTTTGATAGGTTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1740s1c1
Sequence:CCGGCCTGAAGGATTAGATGTGGAACTCGAGTTCCACATCTAATCCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1295s1c1
Sequence:CCGGCGAGAAGTGGTCAAGCTAGAACTCGAGTTCTAGCTTGACCACTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1826s1c1
Sequence:CCGGGATGCCATTGAGTGAGTGAAACTCGAGTTTCACTCACTCAATGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1187s1c1
Sequence:CCGGCGTCTTTACAAGGTAGCCGTTCTCGAGAACGGCTACCTTGTAAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1158s1c1
Sequence:CCGGGTGGAGTTATTTCCTGCATTTCTCGAGAAATGCAGGAAATAACTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1646s1c1
Sequence:CCGGCCTCCCAAAGTACTGGGATTACTCGAGTAATCCCAGTACTTTGGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1145s1c1
Sequence:CCGGGCATTAACCTTACGTGGAGTTCTCGAGAACTCCACGTAAGGTTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016534
MAPKAPK5-AS1 MISSION shRNA Lentiviral Transduction Particles
MAPKAPK5 antisense RNA 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1349s1c1
Sequence:CCGGCGATAACCTATCAAAGGGCTTCTCGAGAAGCCCTTTGATAGGTTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1740s1c1
Sequence:CCGGCCTGAAGGATTAGATGTGGAACTCGAGTTCCACATCTAATCCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1295s1c1
Sequence:CCGGCGAGAAGTGGTCAAGCTAGAACTCGAGTTCTAGCTTGACCACTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1826s1c1
Sequence:CCGGGATGCCATTGAGTGAGTGAAACTCGAGTTTCACTCACTCAATGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1187s1c1
Sequence:CCGGCGTCTTTACAAGGTAGCCGTTCTCGAGAACGGCTACCTTGTAAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1158s1c1
Sequence:CCGGGTGGAGTTATTTCCTGCATTTCTCGAGAAATGCAGGAAATAACTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1646s1c1
Sequence:CCGGCCTCCCAAAGTACTGGGATTACTCGAGTAATCCCAGTACTTTGGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016534.2-1145s1c1
Sequence:CCGGGCATTAACCTTACGTGGAGTTCTCGAGAACTCCACGTAAGGTTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)