EMAIL THIS PAGE TO A FRIEND

MAPKAPK5

mitogen-activated protein kinase-activated protein kinase 5

84 Gene Product Result for
Synonyms: MAPKAP-K5 MK-5 MK5 PRAK
UniProtKB ID: Q8IW41, B3KVA5, O60491, Q86X46, Q9BVX9, Q9UG86
Gene ID:
Human(8550) Summary: The protein encoded by this gene is a tumor suppressor and member of the serine/threonine kinase family. In response to cellular stress and proinflammatory cytokines, this kinase is activated through its phosphorylation by MAP kinases including MAPK1/ERK, MAPK14/p38-alpha, and MAPK11/p38-beta. The encoded protein is found in the nucleus but translocates to the cytoplasm upon phosphorylation and activation. This kinase phosphorylates heat shock protein HSP27 at its physiologically relevant sites. Two alternately spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2012]
Mouse(17165) MAP kinase-activated protein kinase 5
Rat(498183) mitogen-activated protein kinase-activated protein kinase 5
naked mole-rat(101703557) mitogen-activated protein kinase-activated protein kinase 5
domestic guinea pig(100730794) mitogen-activated protein kinase-activated protein kinase 5
sheep(101116258) mitogen-activated protein kinase-activated protein kinase 5
Zebrafish(436608) mitogen-activated protein kinase-activated protein kinase 5
chicken(373929) mitogen-activated protein kinase-activated protein kinase 5
dog(477480) mitogen-activated protein kinase-activated protein kinase 5
cow(535625) mitogen-activated protein kinase-activated protein kinase 5
Horse(100057579) mitogen-activated protein kinase-activated protein kinase 5
domestic cat(101082699) mitogen-activated protein kinase-activated protein kinase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406682 Anti-MAPKAPK5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA015515 Anti-MAPKAPK5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503416 Anti-MAPKAPK5 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
SAB1411538 Anti-MAPKAPK5 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
SAB1302566 ANTI-MOUSE MAPKAPK5 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4504710 Anti-phospho-MAPKAPK5 (pThr182) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1305340 ANTI-PRAK (MAPKAPK5) (T182) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
WH0008550M1 Monoclonal Anti-MAPKAPK5 antibody produced in mouse clone 2D5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300428 Monoclonal Anti-MAPKAPK5 antibody produced in mouse clone 7H10B4, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB1404597 Monoclonal Anti-MAPKAPK5, (C-terminal) antibody produced in mouse clone 3D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003668 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016411 MISSION® esiRNA esiRNA targeting human MAPKAPK5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003668 siRNAs that have been validated in the lab human pricing
NM_139078 Rosetta Predictions human pricing
NM_001025761 Rosetta Predictions rat pricing
NM_010765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003668 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159253 validated 1081
1 SASI_Hs01_00159254 validated 468
2 SASI_Hs01_00159255 predicted 340
3 SASI_Hs01_00159256 predicted 382
4 SASI_Hs01_00159257 predicted 473
5 SASI_Hs01_00159258 predicted 776
6 SASI_Hs01_00159259 predicted 353
7 SASI_Hs01_00159260 predicted 434
8 SASI_Hs01_00159261 predicted 578
9 SASI_Hs01_00159262 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231419 predicted 1079
2 SASI_Hs01_00231420 predicted 472
3 SASI_Hs01_00231421 predicted 346
4 SASI_Hs01_00231422 predicted 382
5 SASI_Hs01_00231423 predicted 472
6 SASI_Hs01_00231424 predicted 774
7 SASI_Hs01_00231425 predicted 358
8 SASI_Hs01_00231426 predicted 435
9 SASI_Hs01_00231427 predicted 581
10 SASI_Hs01_00231428 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087662 predicted 353
2 SASI_Rn02_00203432 predicted 207
3 SASI_Rn01_00087663 predicted 889
4 SASI_Rn01_00087664 predicted 935
5 SASI_Rn01_00087665 predicted 413
6 SASI_Rn01_00087666 predicted 900
7 SASI_Rn01_00087667 predicted 641
8 SASI_Rn01_00087668 predicted 927
9 SASI_Rn01_00087670 predicted 706
10 SASI_Rn01_00087671 predicted 896
11 SASI_Rn01_00087669 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132670 predicted 778
2 SASI_Mm01_00132671 predicted 1489
3 SASI_Mm01_00132672 predicted 1805
4 SASI_Mm01_00132673 predicted 1535
5 SASI_Mm01_00132674 predicted 881
6 SASI_Mm01_00132675 predicted 834
7 SASI_Mm01_00132676 predicted 836
8 SASI_Mm01_00132677 predicted 1822
9 SASI_Mm01_00132678 predicted 1911
10 SASI_Mm01_00132679 predicted 1439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003668
VALIDATED
MAPKAPK5 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase-activated protein kinase 5
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-1622s21c1
Sequence:CCGGGAAATTGTGAAGCAGGTGATACTCGAGTATCACCTGCTTCACAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003668.2-1854s21c1
Sequence:CCGGAGTTCTAGAGACATACTATTACTCGAGTAATAGTATGTCTCTAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-1594s21c1
Sequence:CCGGAGATAAAGTAGATCGACTAAACTCGAGTTTAGTCGATCTACTTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-475s21c1
Sequence:CCGGCCCAAACATAGTTCAGATTATCTCGAGATAATCTGAACTATGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-855s21c1
Sequence:CCGGGAAGGCATCAGAAGGAGAAATCTCGAGATTTCTCCTTCTGATGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003668.x-1788s1c1
Sequence:CCGGGCTGTATAGATTTAGGGTGCACTCGAGTGCACCCTAAATCTATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003668.x-855s1c1
Sequence:CCGGGAAGGCATCAGAAGGAGAAATCTCGAGATTTCTCCTTCTGATGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.x-667s1c1
Sequence:CCGGGCGGCACTGTCACTTGTTAAACTCGAGTTTAACAAGTGACAGTGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.x-1622s1c1
Sequence:CCGGGAAATTGTGAAGCAGGTGATACTCGAGTATCACCTGCTTCACAATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003668.x-898s1c1
Sequence:CCGGGACGCCCTACACTTACAACAACTCGAGTTGTTGTAAGTGTAGGGCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003668.2-1796s1c1
Sequence:CCGGGATTTAGGGTGCAGGACTTAACTCGAGTTAAGTCCTGCACCCTAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.2-475s1c1
Sequence:CCGGCCCAAACATAGTTCAGATTATCTCGAGATAATCTGAACTATGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003668.2-1910s1c1
Sequence:CCGGCAGATGATGCTGTCAAGCAATCTCGAGATTGCTTGACAGCATCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.2-1367s1c1
Sequence:CCGGCCAAAGGACAGTGTCTATATCCTCGAGGATATAGACACTGTCCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.2-319s1c1
Sequence:CCGGCAGTATCAATTGGACTCAGAACTCGAGTTCTGAGTCCAATTGATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003668
VALIDATED
MAPKAPK5 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase-activated protein kinase 5
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-1622s21c1
Sequence:CCGGGAAATTGTGAAGCAGGTGATACTCGAGTATCACCTGCTTCACAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003668.2-1854s21c1
Sequence:CCGGAGTTCTAGAGACATACTATTACTCGAGTAATAGTATGTCTCTAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-1594s21c1
Sequence:CCGGAGATAAAGTAGATCGACTAAACTCGAGTTTAGTCGATCTACTTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-475s21c1
Sequence:CCGGCCCAAACATAGTTCAGATTATCTCGAGATAATCTGAACTATGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-855s21c1
Sequence:CCGGGAAGGCATCAGAAGGAGAAATCTCGAGATTTCTCCTTCTGATGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003668.x-1788s1c1
Sequence:CCGGGCTGTATAGATTTAGGGTGCACTCGAGTGCACCCTAAATCTATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003668.x-855s1c1
Sequence:CCGGGAAGGCATCAGAAGGAGAAATCTCGAGATTTCTCCTTCTGATGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.x-667s1c1
Sequence:CCGGGCGGCACTGTCACTTGTTAAACTCGAGTTTAACAAGTGACAGTGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.x-1622s1c1
Sequence:CCGGGAAATTGTGAAGCAGGTGATACTCGAGTATCACCTGCTTCACAATTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003668.x-898s1c1
Sequence:CCGGGACGCCCTACACTTACAACAACTCGAGTTGTTGTAAGTGTAGGGCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003668.2-1796s1c1
Sequence:CCGGGATTTAGGGTGCAGGACTTAACTCGAGTTAAGTCCTGCACCCTAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.2-475s1c1
Sequence:CCGGCCCAAACATAGTTCAGATTATCTCGAGATAATCTGAACTATGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003668.2-1910s1c1
Sequence:CCGGCAGATGATGCTGTCAAGCAATCTCGAGATTGCTTGACAGCATCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.2-1367s1c1
Sequence:CCGGCCAAAGGACAGTGTCTATATCCTCGAGGATATAGACACTGTCCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.2-319s1c1
Sequence:CCGGCAGTATCAATTGGACTCAGAACTCGAGTTCTGAGTCCAATTGATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003668
VALIDATED
MAPKAPK5 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase-activated protein kinase 5
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-1622s21c1
Sequence:CCGGGAAATTGTGAAGCAGGTGATACTCGAGTATCACCTGCTTCACAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003668.2-1854s21c1
Sequence:CCGGAGTTCTAGAGACATACTATTACTCGAGTAATAGTATGTCTCTAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-1594s21c1
Sequence:CCGGAGATAAAGTAGATCGACTAAACTCGAGTTTAGTCGATCTACTTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-475s21c1
Sequence:CCGGCCCAAACATAGTTCAGATTATCTCGAGATAATCTGAACTATGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003668.2-855s21c1
Sequence:CCGGGAAGGCATCAGAAGGAGAAATCTCGAGATTTCTCCTTCTGATGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003668.x-1788s1c1
Sequence:CCGGGCTGTATAGATTTAGGGTGCACTCGAGTGCACCCTAAATCTATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003668.x-855s1c1
Sequence:CCGGGAAGGCATCAGAAGGAGAAATCTCGAGATTTCTCCTTCTGATGCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.x-667s1c1
Sequence:CCGGGCGGCACTGTCACTTGTTAAACTCGAGTTTAACAAGTGACAGTGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.x-1622s1c1
Sequence:CCGGGAAATTGTGAAGCAGGTGATACTCGAGTATCACCTGCTTCACAATTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003668.x-898s1c1
Sequence:CCGGGACGCCCTACACTTACAACAACTCGAGTTGTTGTAAGTGTAGGGCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003668.2-1796s1c1
Sequence:CCGGGATTTAGGGTGCAGGACTTAACTCGAGTTAAGTCCTGCACCCTAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.2-475s1c1
Sequence:CCGGCCCAAACATAGTTCAGATTATCTCGAGATAATCTGAACTATGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003668.2-1910s1c1
Sequence:CCGGCAGATGATGCTGTCAAGCAATCTCGAGATTGCTTGACAGCATCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.2-1367s1c1
Sequence:CCGGCCAAAGGACAGTGTCTATATCCTCGAGGATATAGACACTGTCCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003668.2-319s1c1
Sequence:CCGGCAGTATCAATTGGACTCAGAACTCGAGTTCTGAGTCCAATTGATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010765
VALIDATED
MAPKAPK5 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase-activated protein kinase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010765.1-795s1c1
Sequence:CCGGCCGGAATTAGTGGTCCAGTTACTCGAGTAACTGGACCACTAATTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-1223s1c1
Sequence:CCGGGCTAAAGTTGACCAAGGTGATCTCGAGATCACCTTGGTCAACTTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-1117s1c1
Sequence:CCGGGCACTGTCACTTGCTAAACATCTCGAGATGTTTAGCAAGTGACAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-1809s1c1
Sequence:CCGGCCAAGCCAAAGGACGGTATTTCTCGAGAAATACCGTCCTTTGGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-923s1c1
Sequence:CCGGCCCAACATAGTTCAGATTATTCTCGAGAATAATCTGAACTATGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010765
VALIDATED
MAPKAPK5 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase-activated protein kinase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010765.1-795s1c1
Sequence:CCGGCCGGAATTAGTGGTCCAGTTACTCGAGTAACTGGACCACTAATTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-1223s1c1
Sequence:CCGGGCTAAAGTTGACCAAGGTGATCTCGAGATCACCTTGGTCAACTTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-1117s1c1
Sequence:CCGGGCACTGTCACTTGCTAAACATCTCGAGATGTTTAGCAAGTGACAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-1809s1c1
Sequence:CCGGCCAAGCCAAAGGACGGTATTTCTCGAGAAATACCGTCCTTTGGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-923s1c1
Sequence:CCGGCCCAACATAGTTCAGATTATTCTCGAGAATAATCTGAACTATGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010765
VALIDATED
MAPKAPK5 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase-activated protein kinase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010765.1-795s1c1
Sequence:CCGGCCGGAATTAGTGGTCCAGTTACTCGAGTAACTGGACCACTAATTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-1223s1c1
Sequence:CCGGGCTAAAGTTGACCAAGGTGATCTCGAGATCACCTTGGTCAACTTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-1117s1c1
Sequence:CCGGGCACTGTCACTTGCTAAACATCTCGAGATGTTTAGCAAGTGACAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-1809s1c1
Sequence:CCGGCCAAGCCAAAGGACGGTATTTCTCGAGAAATACCGTCCTTTGGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010765.1-923s1c1
Sequence:CCGGCCCAACATAGTTCAGATTATTCTCGAGAATAATCTGAACTATGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)