EMAIL THIS PAGE TO A FRIEND

MAPKBP1

mitogen-activated protein kinase binding protein 1

129 Gene Product Result for
Synonyms: JNKBP-1
Gene ID:
Mouse(26390) mitogen-activated protein kinase binding protein 1
Rat(362197) mitogen activated protein kinase binding protein 1
chicken(771487) mitogen-activated protein kinase binding protein 1
cow(788366) mitogen-activated protein kinase binding protein 1
Horse(100071073) mitogen-activated protein kinase binding protein 1
domestic cat(101083596) mitogen-activated protein kinase binding protein 1
dog(487511) mitogen-activated protein kinase binding protein 1
sheep(101114779) mitogen-activated protein kinase binding protein 1
domestic guinea pig(100721000) mitogen-activated protein kinase binding protein 1
naked mole-rat(101702714) mitogen-activated protein kinase binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_031706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_031706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_031706 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014994 Rosetta Predictions human pricing
NM_001108589 Rosetta Predictions rat pricing
NM_011941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175704 predicted 1231
2 SASI_Hs01_00175705 predicted 1264
3 SASI_Hs01_00175706 predicted 2310
4 SASI_Hs01_00175707 predicted 1212
5 SASI_Hs01_00175709 predicted 2294
6 SASI_Hs01_00175710 predicted 975
7 SASI_Hs02_00346761 predicted 242
8 SASI_Hs01_00175711 predicted 1686
9 SASI_Hs01_00175712 predicted 1049
10 SASI_Hs01_00175713 predicted 4756
11 SASI_Hs01_00175708 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240129 predicted 2236
2 SASI_Rn02_00240130 predicted 2689
3 SASI_Rn02_00240131 predicted 1503
4 SASI_Rn02_00240132 predicted 2932
5 SASI_Rn02_00240133 predicted 1246
6 SASI_Rn02_00240134 predicted 1196
7 SASI_Rn02_00240135 predicted 2056
8 SASI_Rn02_00240136 predicted 274
9 SASI_Rn02_00240137 predicted 3039
10 SASI_Rn02_00240138 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321798 predicted 2429
2 SASI_Mm01_00183660 predicted 2065
3 SASI_Mm02_00321799 predicted 2872
4 SASI_Mm01_00183661 predicted 3122
5 SASI_Mm01_00183662 predicted 4151
6 SASI_Mm01_00183664 predicted 1834
7 SASI_Mm01_00183665 predicted 3052
8 SASI_Mm01_00183666 predicted 4310
9 SASI_Mm01_00183667 predicted 2452
10 SASI_Mm02_00321800 predicted 1081
11 SASI_Mm01_00183663 predicted 2313
12 SASI_Mm01_00183668 predicted 4095
13 SASI_Mm01_00183669 predicted 3835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011941
VALIDATED
MAPKBP1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011941.3-2248s21c1
Sequence:CCGGACCGGAATATTCGGATCTTTACTCGAGTAAAGATCCGAATATTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-1425s21c1
Sequence:CCGGTACAACGACCACAGCATATATCTCGAGATATATGCTGTGGTCGTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-1386s21c1
Sequence:CCGGTTGACCTTCGATCCAACTAATCTCGAGATTAGTTGGATCGAAGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-4881s21c1
Sequence:CCGGCCCAAGAGAAATGCTCTCCATCTCGAGATGGAGAGCATTTCTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-4881s1c1
Sequence:CCGGCCCAAGAGAAATGCTCTCCATCTCGAGATGGAGAGCATTTCTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-2756s1c1
Sequence:CCGGCCTTAGCAAGAGCACCAAGAACTCGAGTTCTTGGTGCTCTTGCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-415s1c1
Sequence:CCGGCCATCAAATTACGCAGAAGTACTCGAGTACTTCTGCGTAATTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-4440s1c1
Sequence:CCGGCCAGTCAACAACCTTCTCCAACTCGAGTTGGAGAAGGTTGTTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011941.2-818s1c1
Sequence:CCGGCCAGCATGACATGATTGTCAACTCGAGTTGACAATCATGTCATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-4086s21c1
Sequence:CCGGGCCAAGCTAGCGCGTAGTATTCTCGAGAATACTACGCGCTAGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011941
VALIDATED
MAPKBP1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011941.3-2248s21c1
Sequence:CCGGACCGGAATATTCGGATCTTTACTCGAGTAAAGATCCGAATATTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-1425s21c1
Sequence:CCGGTACAACGACCACAGCATATATCTCGAGATATATGCTGTGGTCGTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-1386s21c1
Sequence:CCGGTTGACCTTCGATCCAACTAATCTCGAGATTAGTTGGATCGAAGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-4881s21c1
Sequence:CCGGCCCAAGAGAAATGCTCTCCATCTCGAGATGGAGAGCATTTCTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-4881s1c1
Sequence:CCGGCCCAAGAGAAATGCTCTCCATCTCGAGATGGAGAGCATTTCTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-2756s1c1
Sequence:CCGGCCTTAGCAAGAGCACCAAGAACTCGAGTTCTTGGTGCTCTTGCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-415s1c1
Sequence:CCGGCCATCAAATTACGCAGAAGTACTCGAGTACTTCTGCGTAATTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-4440s1c1
Sequence:CCGGCCAGTCAACAACCTTCTCCAACTCGAGTTGGAGAAGGTTGTTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011941.2-818s1c1
Sequence:CCGGCCAGCATGACATGATTGTCAACTCGAGTTGACAATCATGTCATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-4086s21c1
Sequence:CCGGGCCAAGCTAGCGCGTAGTATTCTCGAGAATACTACGCGCTAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011941
VALIDATED
MAPKBP1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011941.3-2248s21c1
Sequence:CCGGACCGGAATATTCGGATCTTTACTCGAGTAAAGATCCGAATATTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-1425s21c1
Sequence:CCGGTACAACGACCACAGCATATATCTCGAGATATATGCTGTGGTCGTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-1386s21c1
Sequence:CCGGTTGACCTTCGATCCAACTAATCTCGAGATTAGTTGGATCGAAGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-4881s21c1
Sequence:CCGGCCCAAGAGAAATGCTCTCCATCTCGAGATGGAGAGCATTTCTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-4881s1c1
Sequence:CCGGCCCAAGAGAAATGCTCTCCATCTCGAGATGGAGAGCATTTCTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-2756s1c1
Sequence:CCGGCCTTAGCAAGAGCACCAAGAACTCGAGTTCTTGGTGCTCTTGCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-415s1c1
Sequence:CCGGCCATCAAATTACGCAGAAGTACTCGAGTACTTCTGCGTAATTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011941.2-4440s1c1
Sequence:CCGGCCAGTCAACAACCTTCTCCAACTCGAGTTGGAGAAGGTTGTTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011941.2-818s1c1
Sequence:CCGGCCAGCATGACATGATTGTCAACTCGAGTTGACAATCATGTCATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011941.3-4086s21c1
Sequence:CCGGGCCAAGCTAGCGCGTAGTATTCTCGAGAATACTACGCGCTAGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_031706
MAPKBP1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase binding protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-373s1c1
Sequence:CCGGCCGATCAGGTTTAGTTGCTTACTCGAGTAAGCAACTAAACCTGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-1242s1c1
Sequence:CCGGCCTTGACCTTTGATCCTACTACTCGAGTAGTAGGATCAAAGGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-2907s1c1
Sequence:CCGGCCCTTGAGACTTCACTCACTACTCGAGTAGTGAGTGAAGTCTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-884s1c1
Sequence:CCGGCGGAACAACCTATTCACTGATCTCGAGATCAGTGAATAGGTTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-658s1c1
Sequence:CCGGCCAGCATGACATGATCGTCAACTCGAGTTGACGATCATGTCATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_031706
MAPKBP1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase binding protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-373s1c1
Sequence:CCGGCCGATCAGGTTTAGTTGCTTACTCGAGTAAGCAACTAAACCTGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-1242s1c1
Sequence:CCGGCCTTGACCTTTGATCCTACTACTCGAGTAGTAGGATCAAAGGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-2907s1c1
Sequence:CCGGCCCTTGAGACTTCACTCACTACTCGAGTAGTGAGTGAAGTCTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-884s1c1
Sequence:CCGGCGGAACAACCTATTCACTGATCTCGAGATCAGTGAATAGGTTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-658s1c1
Sequence:CCGGCCAGCATGACATGATCGTCAACTCGAGTTGACGATCATGTCATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_031706
MAPKBP1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase binding protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-373s1c1
Sequence:CCGGCCGATCAGGTTTAGTTGCTTACTCGAGTAAGCAACTAAACCTGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-1242s1c1
Sequence:CCGGCCTTGACCTTTGATCCTACTACTCGAGTAGTAGGATCAAAGGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-2907s1c1
Sequence:CCGGCCCTTGAGACTTCACTCACTACTCGAGTAGTGAGTGAAGTCTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-884s1c1
Sequence:CCGGCGGAACAACCTATTCACTGATCTCGAGATCAGTGAATAGGTTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031706.8-658s1c1
Sequence:CCGGCCAGCATGACATGATCGTCAACTCGAGTTGACGATCATGTCATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)