EMAIL THIS PAGE TO A FRIEND

MAPRE1

microtubule-associated protein, RP/EB family, member 1

193 Gene Product Result for
Synonyms: EB1
UniProtKB ID: Q15691, B2R6I7, E1P5M8, Q3KQS8
Gene ID:
Human(22919) Summary: The protein encoded by this gene was first identified by its binding to the APC protein which is often mutated in familial and sporadic forms of colorectal cancer. This protein localizes to microtubules, especially the growing ends, in interphase cells. During mitosis, the protein is associated with the centrosomes and spindle microtubules. The protein also associates with components of the dynactin complex and the intermediate chain of cytoplasmic dynein. Because of these associations, it is thought that this protein is involved in the regulation of microtubule structures and chromosome stability. This gene is a member of the RP/EB family. [provided by RefSeq, Jul 2008]
Mouse(13589) microtubule-associated protein, RP/EB family, member 1
Rat(114764) microtubule-associated protein, RP/EB family, member 1
chicken(419288) microtubule-associated protein, RP/EB family, member 1
cow(507845) microtubule-associated protein, RP/EB family, member 1
domestic cat(101092509) microtubule-associated protein, RP/EB family, member 1
dog(100685707) microtubule-associated protein, RP/EB family, member 1
naked mole-rat(101725393) microtubule-associated protein, RP/EB family, member 1
domestic guinea pig(100715917) microtubule-associated protein, RP/EB family, member 1
sheep(101106097) microtubule-associated protein, RP/EB family, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012325 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012325 Rosetta Predictions human pricing
NM_138509 Rosetta Predictions rat pricing
NM_007896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015338 predicted 658
2 SASI_Hs01_00015339 predicted 704
3 SASI_Hs01_00015340 predicted 1054
4 SASI_Hs01_00015341 predicted 800
5 SASI_Hs01_00015342 predicted 886
6 SASI_Hs01_00015343 predicted 241
7 SASI_Hs01_00015345 predicted 1071
8 SASI_Hs01_00015346 predicted 768
9 SASI_Hs01_00015347 predicted 272
10 SASI_Hs02_00344113 predicted 1030
11 SASI_Hs01_00015344 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118776 predicted 799
2 SASI_Rn01_00118777 predicted 941
3 SASI_Rn01_00118778 predicted 795
4 SASI_Rn01_00118779 predicted 746
5 SASI_Rn01_00118780 predicted 272
6 SASI_Rn01_00118782 predicted 861
7 SASI_Rn01_00118783 predicted 259
8 SASI_Rn01_00118784 predicted 720
9 SASI_Rn01_00118785 predicted 493
10 SASI_Rn02_00268109 predicted 657
11 SASI_Rn01_00118781 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312684 predicted 211
2 SASI_Mm02_00312685 predicted 260
3 SASI_Mm01_00101206 predicted 853
4 SASI_Mm01_00101208 predicted 563
5 SASI_Mm01_00101209 predicted 369
6 SASI_Mm01_00101211 predicted 328
7 SASI_Mm02_00312686 predicted 226
8 SASI_Mm01_00101212 predicted 772
9 SASI_Mm01_00101213 predicted 858
10 SASI_Mm01_00101214 predicted 923
11 SASI_Mm01_00101207 predicted 906
12 SASI_Mm01_00101210 predicted 231
13 SASI_Mm01_00101215 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007896
VALIDATED
MAPRE1 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein, RP/EB family, member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007896.3-968s21c1
Sequence:CCGGTCCGAAGTCTTCACTCCAAATCTCGAGATTTGGAGTGAAGACTTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007896.3-740s21c1
Sequence:CCGGGTACTGAAGCTTACTGTTGAACTCGAGTTCAACAGTAAGCTTCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007896.3-502s21c1
Sequence:CCGGAGAGTATGATCCTGTAGCTGCCTCGAGGCAGCTACAGGATCATACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007896.3-285s21c1
Sequence:CCGGTGCTCTTCCCTGGATCCATTGCTCGAGCAATGGATCCAGGGAAGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007896.2-1420s1c1
Sequence:CCGGGCCCAGAAGTAAAGTTTGAAACTCGAGTTTCAAACTTTACTTCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007896.2-480s1c1
Sequence:CCGGGCTTTGAGTAAACCGAAGAAACTCGAGTTTCTTCGGTTTACTCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007896.2-240s1c1
Sequence:CCGGGCTAAGCTAGAACATGAATATCTCGAGATATTCATGTTCTAGCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007896.2-798s1c1
Sequence:CCGGGAAGGCTTTGTGATACCTGATCTCGAGATCAGGTATCACAAAGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007896.2-131s1c1
Sequence:CCGGGCAGTTGAATCTGACAAAGATCTCGAGATCTTTGTCAGATTCAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007896
VALIDATED
MAPRE1 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein, RP/EB family, member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007896.3-968s21c1
Sequence:CCGGTCCGAAGTCTTCACTCCAAATCTCGAGATTTGGAGTGAAGACTTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007896.3-740s21c1
Sequence:CCGGGTACTGAAGCTTACTGTTGAACTCGAGTTCAACAGTAAGCTTCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007896.3-502s21c1
Sequence:CCGGAGAGTATGATCCTGTAGCTGCCTCGAGGCAGCTACAGGATCATACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007896.3-285s21c1
Sequence:CCGGTGCTCTTCCCTGGATCCATTGCTCGAGCAATGGATCCAGGGAAGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007896.2-1420s1c1
Sequence:CCGGGCCCAGAAGTAAAGTTTGAAACTCGAGTTTCAAACTTTACTTCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007896.2-480s1c1
Sequence:CCGGGCTTTGAGTAAACCGAAGAAACTCGAGTTTCTTCGGTTTACTCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007896.2-240s1c1
Sequence:CCGGGCTAAGCTAGAACATGAATATCTCGAGATATTCATGTTCTAGCTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007896.2-798s1c1
Sequence:CCGGGAAGGCTTTGTGATACCTGATCTCGAGATCAGGTATCACAAAGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007896.2-131s1c1
Sequence:CCGGGCAGTTGAATCTGACAAAGATCTCGAGATCTTTGTCAGATTCAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007896
VALIDATED
MAPRE1 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein, RP/EB family, member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007896.3-968s21c1
Sequence:CCGGTCCGAAGTCTTCACTCCAAATCTCGAGATTTGGAGTGAAGACTTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007896.3-740s21c1
Sequence:CCGGGTACTGAAGCTTACTGTTGAACTCGAGTTCAACAGTAAGCTTCAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007896.3-502s21c1
Sequence:CCGGAGAGTATGATCCTGTAGCTGCCTCGAGGCAGCTACAGGATCATACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007896.3-285s21c1
Sequence:CCGGTGCTCTTCCCTGGATCCATTGCTCGAGCAATGGATCCAGGGAAGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007896.2-1420s1c1
Sequence:CCGGGCCCAGAAGTAAAGTTTGAAACTCGAGTTTCAAACTTTACTTCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007896.2-480s1c1
Sequence:CCGGGCTTTGAGTAAACCGAAGAAACTCGAGTTTCTTCGGTTTACTCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007896.2-240s1c1
Sequence:CCGGGCTAAGCTAGAACATGAATATCTCGAGATATTCATGTTCTAGCTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007896.2-798s1c1
Sequence:CCGGGAAGGCTTTGTGATACCTGATCTCGAGATCAGGTATCACAAAGCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007896.2-131s1c1
Sequence:CCGGGCAGTTGAATCTGACAAAGATCTCGAGATCTTTGTCAGATTCAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012325
VALIDATED
MAPRE1 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein, RP/EB family, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-730s21c1
Sequence:CCGGGCAGCAGGTCAACGTATTGAACTCGAGTTCAATACGTTGACCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-461s21c1
Sequence:CCGGGTTCAGTGGTTCAAGAAGTTTCTCGAGAAACTTCTTGAACCACTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-848s21c1
Sequence:CCGGCCTGTATTGCAGAGGATTGTACTCGAGTACAATCCTCTGCAATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-572s21c1
Sequence:CCGGGCTCTGAATAAACCGAAGAAACTCGAGTTTCTTCGGTTTATTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-778s21c1
Sequence:CCGGGAGGGATTTCTACTTCGGAAACTCGAGTTTCCGAAGTAGAAATCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-497s1c1
Sequence:CCGGGCTCTGAATAAACCGAAGAAACTCGAGTTTCTTCGGTTTATTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-773s1c1
Sequence:CCGGCCTGTATTGCAGAGGATTGTACTCGAGTACAATCCTCTGCAATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-655s1c1
Sequence:CCGGGCAGCAGGTCAACGTATTGAACTCGAGTTCAATACGTTGACCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-703s1c1
Sequence:CCGGGAGGGATTTCTACTTCGGAAACTCGAGTTTCCGAAGTAGAAATCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-386s1c1
Sequence:CCGGGTTCAGTGGTTCAAGAAGTTTCTCGAGAAACTTCTTGAACCACTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012325
VALIDATED
MAPRE1 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein, RP/EB family, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-730s21c1
Sequence:CCGGGCAGCAGGTCAACGTATTGAACTCGAGTTCAATACGTTGACCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-461s21c1
Sequence:CCGGGTTCAGTGGTTCAAGAAGTTTCTCGAGAAACTTCTTGAACCACTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-848s21c1
Sequence:CCGGCCTGTATTGCAGAGGATTGTACTCGAGTACAATCCTCTGCAATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-572s21c1
Sequence:CCGGGCTCTGAATAAACCGAAGAAACTCGAGTTTCTTCGGTTTATTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-778s21c1
Sequence:CCGGGAGGGATTTCTACTTCGGAAACTCGAGTTTCCGAAGTAGAAATCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-497s1c1
Sequence:CCGGGCTCTGAATAAACCGAAGAAACTCGAGTTTCTTCGGTTTATTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-773s1c1
Sequence:CCGGCCTGTATTGCAGAGGATTGTACTCGAGTACAATCCTCTGCAATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-655s1c1
Sequence:CCGGGCAGCAGGTCAACGTATTGAACTCGAGTTCAATACGTTGACCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-703s1c1
Sequence:CCGGGAGGGATTTCTACTTCGGAAACTCGAGTTTCCGAAGTAGAAATCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-386s1c1
Sequence:CCGGGTTCAGTGGTTCAAGAAGTTTCTCGAGAAACTTCTTGAACCACTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012325
VALIDATED
MAPRE1 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein, RP/EB family, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-730s21c1
Sequence:CCGGGCAGCAGGTCAACGTATTGAACTCGAGTTCAATACGTTGACCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-461s21c1
Sequence:CCGGGTTCAGTGGTTCAAGAAGTTTCTCGAGAAACTTCTTGAACCACTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-848s21c1
Sequence:CCGGCCTGTATTGCAGAGGATTGTACTCGAGTACAATCCTCTGCAATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-572s21c1
Sequence:CCGGGCTCTGAATAAACCGAAGAAACTCGAGTTTCTTCGGTTTATTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012325.2-778s21c1
Sequence:CCGGGAGGGATTTCTACTTCGGAAACTCGAGTTTCCGAAGTAGAAATCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-497s1c1
Sequence:CCGGGCTCTGAATAAACCGAAGAAACTCGAGTTTCTTCGGTTTATTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-773s1c1
Sequence:CCGGCCTGTATTGCAGAGGATTGTACTCGAGTACAATCCTCTGCAATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-655s1c1
Sequence:CCGGGCAGCAGGTCAACGTATTGAACTCGAGTTCAATACGTTGACCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-703s1c1
Sequence:CCGGGAGGGATTTCTACTTCGGAAACTCGAGTTTCCGAAGTAGAAATCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012325.1-386s1c1
Sequence:CCGGGTTCAGTGGTTCAAGAAGTTTCTCGAGAAACTTCTTGAACCACTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)