EMAIL THIS PAGE TO A FRIEND

MAPRE2

microtubule-associated protein, RP/EB family, member 2

225 Gene Product Result for
Synonyms: EB1 EB2 RP1
Gene ID:
Human(10982) Summary: The protein encoded by this gene shares significant homology to the adenomatous polyposis coli (APC) protein-binding EB1 gene family. This protein is a microtubule-associated protein that is necessary for spindle symmetry during mitosis. It is thought to play a role in the tumorigenesis of colorectal cancers and the proliferative control of normal cells. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(212307) microtubule-associated protein, RP/EB family, member 2
Rat(679221) microtubule-associated protein, RP/EB family, member 2
chicken(421105) microtubule-associated protein, RP/EB family, member 2
dog(490487) microtubule-associated protein, RP/EB family, member 2
domestic cat(101092800) microtubule-associated protein, RP/EB family, member 2
cow(510159) microtubule-associated protein, RP/EB family, member 2
sheep(101110894) microtubule-associated protein, RP/EB family, member 2
domestic guinea pig(100736040) microtubule-associated protein, RP/EB family, member 2
naked mole-rat(101705572) microtubule-associated protein, RP/EB family, member 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014268 Rosetta Predictions human pricing
NM_001101000 Rosetta Predictions rat pricing
NM_153058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160928 predicted 1129
2 SASI_Hs01_00160929 predicted 493
3 SASI_Hs01_00160931 predicted 487
4 SASI_Hs01_00160932 predicted 835
5 SASI_Hs01_00160933 predicted 1117
6 SASI_Hs01_00160934 predicted 442
7 SASI_Hs01_00160935 predicted 362
8 SASI_Hs01_00160936 predicted 261
9 SASI_Hs01_00160937 predicted 601
10 SASI_Hs02_00345333 predicted 472
11 SASI_Hs01_00160930 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211126 predicted 406
2 SASI_Rn02_00211127 predicted 357
3 SASI_Rn02_00211128 predicted 275
4 SASI_Rn02_00211129 predicted 342
5 SASI_Rn02_00211130 predicted 749
6 SASI_Rn02_00211131 predicted 511
7 SASI_Rn02_00211132 predicted 947
8 SASI_Rn02_00211133 predicted 396
9 SASI_Rn02_00211134 predicted 763
10 SASI_Rn02_00211135 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195405 predicted 434
2 SASI_Mm01_00195406 predicted 489
3 SASI_Mm01_00195407 predicted 445
4 SASI_Mm01_00195408 predicted 1099
5 SASI_Mm01_00195409 predicted 901
6 SASI_Mm01_00195410 predicted 578
7 SASI_Mm01_00195411 predicted 816
8 SASI_Mm02_00342872 predicted 585
9 SASI_Mm01_00195413 predicted 279
10 SASI_Mm01_00195414 predicted 265
11 SASI_Mm01_00195412 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014268
VALIDATED
MAPRE2 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein, RP/EB family, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-662s21c1
Sequence:CCGGACTACGATGGGAAGGAGTATGCTCGAGCATACTCCTTCCCATCGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-320s21c1
Sequence:CCGGATGTGTATTCTACCTCGATAACTCGAGTTATCGAGGTAGAATACACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014268.1-169s1c1
Sequence:CCGGCCAGGATAATAACGGGACCATCTCGAGATGGTCCCGTTATTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-375s21c1
Sequence:CCGGATGGGTTAATGACATAGTATCCTCGAGGATACTATGTCATTAACCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014268.1-1106s1c1
Sequence:CCGGGCTGCTCTTGACACTTCCATTCTCGAGAATGGAAGTGTCAAGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014268.1-475s1c1
Sequence:CCGGGCAAGCATCATTTAAGCGAATCTCGAGATTCGCTTAAATGATGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014268.1-849s1c1
Sequence:CCGGAGCTTAATGAACAGGTACATTCTCGAGAATGTACCTGTTCATTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014268.1-809s1c1
Sequence:CCGGGCATCCAAATCCGATAAAGATCTCGAGATCTTTATCGGATTTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-423s21c1
Sequence:CCGGTTGTTCAGGAGCGGCCTATTGCTCGAGCAATAGGCCGCTCCTGAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014268
VALIDATED
MAPRE2 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein, RP/EB family, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-662s21c1
Sequence:CCGGACTACGATGGGAAGGAGTATGCTCGAGCATACTCCTTCCCATCGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-320s21c1
Sequence:CCGGATGTGTATTCTACCTCGATAACTCGAGTTATCGAGGTAGAATACACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014268.1-169s1c1
Sequence:CCGGCCAGGATAATAACGGGACCATCTCGAGATGGTCCCGTTATTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-375s21c1
Sequence:CCGGATGGGTTAATGACATAGTATCCTCGAGGATACTATGTCATTAACCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014268.1-1106s1c1
Sequence:CCGGGCTGCTCTTGACACTTCCATTCTCGAGAATGGAAGTGTCAAGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014268.1-475s1c1
Sequence:CCGGGCAAGCATCATTTAAGCGAATCTCGAGATTCGCTTAAATGATGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014268.1-849s1c1
Sequence:CCGGAGCTTAATGAACAGGTACATTCTCGAGAATGTACCTGTTCATTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014268.1-809s1c1
Sequence:CCGGGCATCCAAATCCGATAAAGATCTCGAGATCTTTATCGGATTTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-423s21c1
Sequence:CCGGTTGTTCAGGAGCGGCCTATTGCTCGAGCAATAGGCCGCTCCTGAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014268
VALIDATED
MAPRE2 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein, RP/EB family, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-662s21c1
Sequence:CCGGACTACGATGGGAAGGAGTATGCTCGAGCATACTCCTTCCCATCGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-320s21c1
Sequence:CCGGATGTGTATTCTACCTCGATAACTCGAGTTATCGAGGTAGAATACACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014268.1-169s1c1
Sequence:CCGGCCAGGATAATAACGGGACCATCTCGAGATGGTCCCGTTATTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-375s21c1
Sequence:CCGGATGGGTTAATGACATAGTATCCTCGAGGATACTATGTCATTAACCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014268.1-1106s1c1
Sequence:CCGGGCTGCTCTTGACACTTCCATTCTCGAGAATGGAAGTGTCAAGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014268.1-475s1c1
Sequence:CCGGGCAAGCATCATTTAAGCGAATCTCGAGATTCGCTTAAATGATGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014268.1-849s1c1
Sequence:CCGGAGCTTAATGAACAGGTACATTCTCGAGAATGTACCTGTTCATTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014268.1-809s1c1
Sequence:CCGGGCATCCAAATCCGATAAAGATCTCGAGATCTTTATCGGATTTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014268.2-423s21c1
Sequence:CCGGTTGTTCAGGAGCGGCCTATTGCTCGAGCAATAGGCCGCTCCTGAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153058
MAPRE2 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein, RP/EB family, member 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.4-270s21c1
Sequence:CCGGATGTGTATTCTACCTCGATAACTCGAGTTATCGAGGTAGAATACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153058.4-1557s21c1
Sequence:CCGGGTCTAACCTCCTCTCATAAATCTCGAGATTTATGAGAGGAGGTTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-292s21c1
Sequence:CCGGGCAGGCATGACATCATTGCATCTCGAGATGCAATGATGTCATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153058.3-1501s21c1
Sequence:CCGGCAGTAGCTGTCACGCGCATTTCTCGAGAAATGCGCGTGACAGCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-178s21c1
Sequence:CCGGAGGATAACGGGACTATCATTCCTCGAGGAATGATAGTCCCGTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.4-453s21c1
Sequence:CCGGCAAAGTTGGAGCATGAGTATACTCGAGTATACTCATGCTCCAACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-484s1c1
Sequence:CCGGGCATCCTTTAAACGGATGAATCTCGAGATTCATCCGTTTAAAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-327s1c1
Sequence:CCGGCGTGTCTCTAAACTACACAAACTCGAGTTTGTGTAGTTTAGAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-977s21c1
Sequence:CCGGTGACCTCGTGCAGCGACTAATCTCGAGATTAGTCGCTGCACGAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153058.2-3268s1c1
Sequence:CCGGCCCATCTTAAATACCTTGAAACTCGAGTTTCAAGGTATTTAAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-293s1c1
Sequence:CCGGGCAGGCATGACATCATTGCATCTCGAGATGCAATGATGTCATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-591s1c1
Sequence:CCGGCGATGCTAACTATGACGGGAACTCGAGTTCCCGTCATAGTTAGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-326s21c1
Sequence:CCGGCGTGTCTCTAAACTACACAAACTCGAGTTTGTGTAGTTTAGAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153058
MAPRE2 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein, RP/EB family, member 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.4-270s21c1
Sequence:CCGGATGTGTATTCTACCTCGATAACTCGAGTTATCGAGGTAGAATACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153058.4-1557s21c1
Sequence:CCGGGTCTAACCTCCTCTCATAAATCTCGAGATTTATGAGAGGAGGTTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-292s21c1
Sequence:CCGGGCAGGCATGACATCATTGCATCTCGAGATGCAATGATGTCATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153058.3-1501s21c1
Sequence:CCGGCAGTAGCTGTCACGCGCATTTCTCGAGAAATGCGCGTGACAGCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-178s21c1
Sequence:CCGGAGGATAACGGGACTATCATTCCTCGAGGAATGATAGTCCCGTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.4-453s21c1
Sequence:CCGGCAAAGTTGGAGCATGAGTATACTCGAGTATACTCATGCTCCAACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-484s1c1
Sequence:CCGGGCATCCTTTAAACGGATGAATCTCGAGATTCATCCGTTTAAAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-327s1c1
Sequence:CCGGCGTGTCTCTAAACTACACAAACTCGAGTTTGTGTAGTTTAGAGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-977s21c1
Sequence:CCGGTGACCTCGTGCAGCGACTAATCTCGAGATTAGTCGCTGCACGAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153058.2-3268s1c1
Sequence:CCGGCCCATCTTAAATACCTTGAAACTCGAGTTTCAAGGTATTTAAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-293s1c1
Sequence:CCGGGCAGGCATGACATCATTGCATCTCGAGATGCAATGATGTCATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-591s1c1
Sequence:CCGGCGATGCTAACTATGACGGGAACTCGAGTTCCCGTCATAGTTAGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-326s21c1
Sequence:CCGGCGTGTCTCTAAACTACACAAACTCGAGTTTGTGTAGTTTAGAGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153058
MAPRE2 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein, RP/EB family, member 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.4-270s21c1
Sequence:CCGGATGTGTATTCTACCTCGATAACTCGAGTTATCGAGGTAGAATACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153058.4-1557s21c1
Sequence:CCGGGTCTAACCTCCTCTCATAAATCTCGAGATTTATGAGAGGAGGTTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-292s21c1
Sequence:CCGGGCAGGCATGACATCATTGCATCTCGAGATGCAATGATGTCATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153058.3-1501s21c1
Sequence:CCGGCAGTAGCTGTCACGCGCATTTCTCGAGAAATGCGCGTGACAGCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-178s21c1
Sequence:CCGGAGGATAACGGGACTATCATTCCTCGAGGAATGATAGTCCCGTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.4-453s21c1
Sequence:CCGGCAAAGTTGGAGCATGAGTATACTCGAGTATACTCATGCTCCAACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-484s1c1
Sequence:CCGGGCATCCTTTAAACGGATGAATCTCGAGATTCATCCGTTTAAAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-327s1c1
Sequence:CCGGCGTGTCTCTAAACTACACAAACTCGAGTTTGTGTAGTTTAGAGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-977s21c1
Sequence:CCGGTGACCTCGTGCAGCGACTAATCTCGAGATTAGTCGCTGCACGAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153058.2-3268s1c1
Sequence:CCGGCCCATCTTAAATACCTTGAAACTCGAGTTTCAAGGTATTTAAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-293s1c1
Sequence:CCGGGCAGGCATGACATCATTGCATCTCGAGATGCAATGATGTCATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153058.2-591s1c1
Sequence:CCGGCGATGCTAACTATGACGGGAACTCGAGTTCCCGTCATAGTTAGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153058.3-326s21c1
Sequence:CCGGCGTGTCTCTAAACTACACAAACTCGAGTTTGTGTAGTTTAGAGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)