EMAIL THIS PAGE TO A FRIEND

MAPRE3

microtubule-associated protein, RP/EB family, member 3

64 Gene Product Result for
Synonyms: EB3 EBF3 EBF3-S RP3
Gene ID:
Human(22924) Summary: The protein encoded by this gene is a member of the RP/EB family of genes. The protein localizes to the cytoplasmic microtubule network and binds APCL, a homolog of the adenomatous polyposis coli tumor suppressor gene. [provided by RefSeq, Jul 2008]
Mouse(100732) microtubule-associated protein, RP/EB family, member 3
Rat(298848) microtubule-associated protein, RP/EB family, member 3
naked mole-rat(101702024) microtubule-associated protein, RP/EB family, member 3
domestic guinea pig(100714223) microtubule-associated protein, RP/EB family, member 3
sheep(101112123) microtubule-associated protein, RP/EB family, member 3
domestic cat(101081795) microtubule-associated protein, RP/EB family, member 3
cow(528839) microtubule-associated protein, RP/EB family, member 3
dog(475694) microtubule-associated protein, RP/EB family, member 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012326 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012326 Rosetta Predictions human pricing
NM_001007656 Rosetta Predictions rat pricing
NM_133350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235516 predicted 418
2 SASI_Hs01_00235517 predicted 1054
3 SASI_Hs01_00235518 predicted 1218
4 SASI_Hs01_00235519 predicted 952
5 SASI_Hs01_00235520 predicted 1217
6 SASI_Hs01_00235521 predicted 339
7 SASI_Hs01_00235522 predicted 394
8 SASI_Hs02_00344114 predicted 426
9 SASI_Hs01_00235524 predicted 341
10 SASI_Hs01_00235525 predicted 1056
11 SASI_Hs01_00235523 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074737 predicted 526
2 SASI_Rn01_00074738 predicted 446
3 SASI_Rn01_00074739 predicted 826
4 SASI_Rn01_00074740 predicted 849
5 SASI_Rn01_00074741 predicted 431
6 SASI_Rn01_00074742 predicted 418
7 SASI_Rn01_00074743 predicted 555
8 SASI_Rn01_00074744 predicted 530
9 SASI_Rn01_00074745 predicted 604
10 SASI_Rn01_00074746 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189574 predicted 815
2 SASI_Mm01_00189575 predicted 557
3 SASI_Mm01_00189577 predicted 467
4 SASI_Mm01_00189578 predicted 897
5 SASI_Mm01_00189579 predicted 456
6 SASI_Mm01_00189580 predicted 195
7 SASI_Mm01_00189581 predicted 809
8 SASI_Mm01_00189582 predicted 595
9 SASI_Mm01_00189583 predicted 812
10 SASI_Mm02_00338529 predicted 394
11 SASI_Mm01_00189576 predicted 580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012326
VALIDATED
MAPRE3 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein, RP/EB family, member 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-489s21c1
Sequence:CCGGGAAATTCTTTGACGCAAACTACTCGAGTAGTTTGCGTCAAAGAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-713s21c1
Sequence:CCGGATCCTCCATCAGCCCGAAATGCTCGAGCATTTCGGGCTGATGGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-428s21c1
Sequence:CCGGCTGTAGAGAAATTAGTGAAAGCTCGAGCTTTCACTAATTTCTCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-1212s21c1
Sequence:CCGGTGTCCACACCCACCCTATTTACTCGAGTAAATAGGGTGGGTGTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-863s21c1
Sequence:CCGGGCCAGGAGCATGAAAGTGAAACTCGAGTTTCACTTTCATGCTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-739s21c1
Sequence:CCGGCATGAGACTGATGCCCAAATTCTCGAGAATTTGGGCATCAGTCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-1331s21c1
Sequence:CCGGTTTGACAAAGTCATTGGTATACTCGAGTATACCAATGACTTTGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012326.2-357s1c1
Sequence:CCGGGCATGAATACATCCACAACTTCTCGAGAAGTTGTGGATGTATTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012326.2-394s1c1
Sequence:CCGGGCTTTCAAGAAGATGGGTGTTCTCGAGAACACCCATCTTCTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012326.2-863s1c1
Sequence:CCGGGCCAGGAGCATGAAAGTGAAACTCGAGTTTCACTTTCATGCTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012326.2-237s1c1
Sequence:CCGGGCACCTCAACTATACCAAGATCTCGAGATCTTGGTATAGTTGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012326.2-888s1c1
Sequence:CCGGCCCTGTTATCTCAGGCATCATCTCGAGATGATGCCTGAGATAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012326
VALIDATED
MAPRE3 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein, RP/EB family, member 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-489s21c1
Sequence:CCGGGAAATTCTTTGACGCAAACTACTCGAGTAGTTTGCGTCAAAGAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-713s21c1
Sequence:CCGGATCCTCCATCAGCCCGAAATGCTCGAGCATTTCGGGCTGATGGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-428s21c1
Sequence:CCGGCTGTAGAGAAATTAGTGAAAGCTCGAGCTTTCACTAATTTCTCTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-1212s21c1
Sequence:CCGGTGTCCACACCCACCCTATTTACTCGAGTAAATAGGGTGGGTGTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-863s21c1
Sequence:CCGGGCCAGGAGCATGAAAGTGAAACTCGAGTTTCACTTTCATGCTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-739s21c1
Sequence:CCGGCATGAGACTGATGCCCAAATTCTCGAGAATTTGGGCATCAGTCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-1331s21c1
Sequence:CCGGTTTGACAAAGTCATTGGTATACTCGAGTATACCAATGACTTTGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012326.2-357s1c1
Sequence:CCGGGCATGAATACATCCACAACTTCTCGAGAAGTTGTGGATGTATTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012326.2-394s1c1
Sequence:CCGGGCTTTCAAGAAGATGGGTGTTCTCGAGAACACCCATCTTCTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012326.2-863s1c1
Sequence:CCGGGCCAGGAGCATGAAAGTGAAACTCGAGTTTCACTTTCATGCTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012326.2-237s1c1
Sequence:CCGGGCACCTCAACTATACCAAGATCTCGAGATCTTGGTATAGTTGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012326.2-888s1c1
Sequence:CCGGCCCTGTTATCTCAGGCATCATCTCGAGATGATGCCTGAGATAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012326
VALIDATED
MAPRE3 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein, RP/EB family, member 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-489s21c1
Sequence:CCGGGAAATTCTTTGACGCAAACTACTCGAGTAGTTTGCGTCAAAGAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-713s21c1
Sequence:CCGGATCCTCCATCAGCCCGAAATGCTCGAGCATTTCGGGCTGATGGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-428s21c1
Sequence:CCGGCTGTAGAGAAATTAGTGAAAGCTCGAGCTTTCACTAATTTCTCTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-1212s21c1
Sequence:CCGGTGTCCACACCCACCCTATTTACTCGAGTAAATAGGGTGGGTGTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-863s21c1
Sequence:CCGGGCCAGGAGCATGAAAGTGAAACTCGAGTTTCACTTTCATGCTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-739s21c1
Sequence:CCGGCATGAGACTGATGCCCAAATTCTCGAGAATTTGGGCATCAGTCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012326.2-1331s21c1
Sequence:CCGGTTTGACAAAGTCATTGGTATACTCGAGTATACCAATGACTTTGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012326.2-357s1c1
Sequence:CCGGGCATGAATACATCCACAACTTCTCGAGAAGTTGTGGATGTATTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012326.2-394s1c1
Sequence:CCGGGCTTTCAAGAAGATGGGTGTTCTCGAGAACACCCATCTTCTTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012326.2-863s1c1
Sequence:CCGGGCCAGGAGCATGAAAGTGAAACTCGAGTTTCACTTTCATGCTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012326.2-237s1c1
Sequence:CCGGGCACCTCAACTATACCAAGATCTCGAGATCTTGGTATAGTTGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012326.2-888s1c1
Sequence:CCGGCCCTGTTATCTCAGGCATCATCTCGAGATGATGCCTGAGATAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133350
MAPRE3 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein, RP/EB family, member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133350.1-424s21c1
Sequence:CCGGCCCGTAGAGAAGTTAGTGAAACTCGAGTTTCACTAACTTCTCTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133350.1-817s21c1
Sequence:CCGGCGAGATTTCTATTTCAGCAAACTCGAGTTTGCTGAAATAGAAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133350.1-1409s21c1
Sequence:CCGGCCTTGCACTTTACCTGTTCTTCTCGAGAAGAACAGGTAAAGTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133350.1-235s21c1
Sequence:CCGGCACCTCAATTATACCAAGATTCTCGAGAATCTTGGTATAATTGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133350.1-1409s1c1
Sequence:CCGGCCTTGCACTTTACCTGTTCTTCTCGAGAAGAACAGGTAAAGTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-234s1c1
Sequence:CCGGGCACCTCAATTATACCAAGATCTCGAGATCTTGGTATAATTGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-817s1c1
Sequence:CCGGCGAGATTTCTATTTCAGCAAACTCGAGTTTGCTGAAATAGAAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-424s1c1
Sequence:CCGGCCCGTAGAGAAGTTAGTGAAACTCGAGTTTCACTAACTTCTCTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-235s1c1
Sequence:CCGGCACCTCAATTATACCAAGATTCTCGAGAATCTTGGTATAATTGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133350
MAPRE3 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein, RP/EB family, member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133350.1-424s21c1
Sequence:CCGGCCCGTAGAGAAGTTAGTGAAACTCGAGTTTCACTAACTTCTCTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133350.1-817s21c1
Sequence:CCGGCGAGATTTCTATTTCAGCAAACTCGAGTTTGCTGAAATAGAAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133350.1-1409s21c1
Sequence:CCGGCCTTGCACTTTACCTGTTCTTCTCGAGAAGAACAGGTAAAGTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133350.1-235s21c1
Sequence:CCGGCACCTCAATTATACCAAGATTCTCGAGAATCTTGGTATAATTGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133350.1-1409s1c1
Sequence:CCGGCCTTGCACTTTACCTGTTCTTCTCGAGAAGAACAGGTAAAGTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-234s1c1
Sequence:CCGGGCACCTCAATTATACCAAGATCTCGAGATCTTGGTATAATTGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-817s1c1
Sequence:CCGGCGAGATTTCTATTTCAGCAAACTCGAGTTTGCTGAAATAGAAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-424s1c1
Sequence:CCGGCCCGTAGAGAAGTTAGTGAAACTCGAGTTTCACTAACTTCTCTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-235s1c1
Sequence:CCGGCACCTCAATTATACCAAGATTCTCGAGAATCTTGGTATAATTGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133350
MAPRE3 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein, RP/EB family, member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133350.1-424s21c1
Sequence:CCGGCCCGTAGAGAAGTTAGTGAAACTCGAGTTTCACTAACTTCTCTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133350.1-817s21c1
Sequence:CCGGCGAGATTTCTATTTCAGCAAACTCGAGTTTGCTGAAATAGAAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133350.1-1409s21c1
Sequence:CCGGCCTTGCACTTTACCTGTTCTTCTCGAGAAGAACAGGTAAAGTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133350.1-235s21c1
Sequence:CCGGCACCTCAATTATACCAAGATTCTCGAGAATCTTGGTATAATTGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133350.1-1409s1c1
Sequence:CCGGCCTTGCACTTTACCTGTTCTTCTCGAGAAGAACAGGTAAAGTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-234s1c1
Sequence:CCGGGCACCTCAATTATACCAAGATCTCGAGATCTTGGTATAATTGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-817s1c1
Sequence:CCGGCGAGATTTCTATTTCAGCAAACTCGAGTTTGCTGAAATAGAAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-424s1c1
Sequence:CCGGCCCGTAGAGAAGTTAGTGAAACTCGAGTTTCACTAACTTCTCTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133350.1-235s1c1
Sequence:CCGGCACCTCAATTATACCAAGATTCTCGAGAATCTTGGTATAATTGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)