EMAIL THIS PAGE TO A FRIEND

MAPT

microtubule-associated protein tau

262 Gene Product Result for
Synonyms: DDPAC FTDP-17 MAPTL MSTD MTBT1 MTBT2 PPND TAU
Gene ID:
Human(4137) Summary: This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008]
Mouse(17762) microtubule-associated protein tau
Rat(29477) microtubule-associated protein tau
chicken(426737) microtubule-associated protein tau
dog(480488) microtubule-associated protein tau
cow(281296) microtubule-associated protein tau
Horse(100054638) microtubule-associated protein tau
domestic cat(101089557) microtubule-associated protein tau
Goat(100860820) microtubule-associated protein tau
sheep(101121024) microtubule-associated protein tau
domestic guinea pig(100735442) microtubule-associated protein tau
naked mole-rat(101719489) microtubule-associated protein tau
Domestic Rabbit(100344003) microtubule-associated protein tau
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300374 Anti-MAPT (Ab-181) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4300375 Anti-MAPT (Ab-205) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4300503 Anti-MAPT (Ab-212) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4300376 Anti-MAPT (Ab-214) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence pricing
SAB4300377 Anti-MAPT (Ab-231) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300373 Anti-MAPT (Ab-235) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB4300378 Anti-MAPT (Ab-262) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4300370 Anti-MAPT (Ab-356) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence pricing
SAB4300371 Anti-MAPT (Ab-396) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300379 Anti-MAPT (Ab-404) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4300516 Anti-MAPT (Ab-422) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
AV48103 Anti-MAPT antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
HPA069524 Anti-MAPT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA069570 Anti-MAPT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA048895 Anti-MAPT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
M7273 Anti-Microtubule-Associated Proteins (MAPs) antibody produced in rabbit whole antiserum mammals
western blot pricing
SAB4300088 Anti-phospho-MAPT (pSer214) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300085 Anti-phospho-MAPT (pSer235) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300090 Anti-phospho-MAPT (pSer262) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300080 Anti-phospho-MAPT (pSer356) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, western blot pricing
SAB4300081 Anti-phospho-MAPT (pSer396) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300091 Anti-phospho-MAPT (pSer404) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300215 Anti-phospho-MAPT (pSer422) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4300086 Anti-phospho-MAPT (pThr181) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300087 Anti-phospho-MAPT (pThr205) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4300089 Anti-phospho-MAPT (pThr231) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4300205 Anti-phospho-MAPT (pThr421) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
T8444 Anti-phospho-Tau (pSer199) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
western blot pricing
T6819 Anti-phospho-Tau (pSer199/202) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
microarray, western blot pricing
SAB4504553 Anti-phospho-Tau (pSer214) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4504554 Anti-phospho-Tau (pSer235) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
T7569 Anti-phospho-Tau (pSer262) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
western blot pricing
SAB4504555 Anti-phospho-Tau (pSer262) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4504556 Anti-phospho-Tau (pSer356) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
T7319 Anti-phospho-Tau (pSer396) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
western blot pricing
SAB4504557 Anti-phospho-Tau (pSer396) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
T1700 Anti-phospho-Tau (pSer400) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
T7444 Anti-phospho-Tau (pSer404) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunohistochemistry, western blot pricing
SAB4504558 Anti-phospho-Tau (pSer404) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504758 Anti-phospho-Tau (pSer516/199) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4504598 Anti-phospho-Tau (pSer519/202) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301285 Anti-phospho-Tau (pSer519/202) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504560 Anti-phospho-Tau (pThr181) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
T6694 Anti-phospho-Tau (pThr205) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB4504561 Anti-phospho-Tau (pThr205) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
T6944 Anti-phospho-Tau (pThr212) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution goat, rhesus monkey, mouse, baboon, bovine, human, rat
western blot pricing
SAB4504562 Anti-phospho-Tau (pThr212) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
T7194 Anti-phospho-Tau (pThr231) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
western blot pricing
SAB4504563 Anti-phospho-Tau (pThr231) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504599 Anti-phospho-Tau (pThr534/217) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301286 Anti-phospho-Tau (pThr534/217) antibody produced in rabbit affinity isolated antibody human
western blot pricing
T6402 Anti-τ (Tau) antibody produced in rabbit whole antiserum rat, chicken, mouse
western blot pricing
SAB1306682 ANTI-TAU (MAPT) (S720) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4501821 Anti-TAU antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4501827 Anti-TAU antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4501828 Anti-TAU antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4501829 Anti-TAU antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4501831 Anti-TAU antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4501832 Anti-TAU antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4200765 Anti-tau antibody, Mouse monoclonal clone tu53, purified from hybridoma cell culture New human, mouse
immunoprecipitation (IP), western blot pricing
T9450 Anti-Tau antibody, Mouse monoclonal clone Tau46, purified from hybridoma cell culture mouse, human, rat, bovine
ELISA, immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB5500182 Anti-TAU antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP70, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB1306711 ANTI-TAU(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501822 Anti-TAU, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4501823 Anti-TAU, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4501824 Anti-TAU, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4501825 Anti-TAU, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4501826 Anti-TAU, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4501830 Anti-TAU, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
T5530 Monoclonal Anti-τ (Tau) antibody produced in mouse clone TAU-2, ascites fluid human, monkey, chicken, bovine
immunohistochemistry, microarray, western blot pricing
T8451 Monoclonal Anti-Tau, First N-terminal Insert antibody produced in mouse clone DC 39N1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
T8326 Monoclonal Anti-Tau-410, C-terminal antibody produced in mouse clone DC39, purified immunoglobulin, buffered aqueous solution rat, mouse, human, pig, rabbit
ELISA, immunofluorescence, immunohistochemistry, radioimmunoassay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005910 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098701 MISSION® esiRNA esiRNA human MAPT (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABN1839 Anti-Amyloid-β (oligomer) Antibody, clone F11G3 This Anti-Amyloid-β (oligomer) Antibody, clone F11G3 is validated for use in Western Blotting, Dot Blot, ELISA, Immunofluorescence, Immunoprecipitation for the detection of Amyloid-β. pricing
36-017 Anti-cleaved-Tau (Asp421) Antibody, clone C3 Anti-cleaved-Tau (Asp421) Antibody, clone C3 is an antibody against cleaved-Tau (Asp421) for use in IP, WB, IH. pricing
05-885 Anti-phospho-Tau (Ser396) Antibody, clone PHF13 Anti-phospho-Tau (Ser396) Antibody, clone PHF13 detects level of phospho-Tau (Ser396) & has been published & validated for use in WB. pricing
MABN388 Anti-phospho Tau (Thr181), clone 1E7 Antibody Anti-phospho Tau (Thr181) antibody, clone 1E7 is an antibody against phospho Tau (Thr181) for use in western blotting. pricing
MAB3420 Anti-Tau-1 Antibody, clone PC1C6 Anti-Tau-1 Antibody, clone PC1C6 is an antibody against Tau-1 for use in IH & WB with more than 65 product citations. pricing
MAB3420A4 Anti-Tau-1 Antibody, clone PC1C6, Alexa Fluor® 488 Conjugate This Anti-Tau-1 Antibody, clone PC1C6, Alexa Fluor 488 Conjugate is validated for use in IC, IH for the detection of Tau-1. pricing
IHCR1015-6 Anti-Tau-1 Antibody, prediluted, clone PC1C6 Detect Tau-1 using this Anti-Tau-1 Antibody, prediluted, clone PC1C6 validated for use in IH(P). pricing
05-803 Anti-Tau (3-repeat isoform RD3) Antibody, clone 8E6/C11 Anti-Tau (3-repeat isoform RD3) Antibody, clone 8E6/C11 is an antibody against Tau (3-repeat isoform RD3) for use in IH & WB. pricing
05-804 Anti-Tau (4-repeat isoform RD4) Antibody, clone 1E1/A6 This Anti-Tau (4-repeat isoform RD4) Antibody, clone 1E1/A6 is validated for use in IH, WB for the detection of Tau (4-repeat isoform RD4). pricing
MABN1185 Anti-Tau (4-repeat isoform RD4) Antibody, clone 7D12.1 This Anti-Tau Antibody, clone 7D12.1 is validated for use in Western Blotting, Immunohistochemistry (Paraffin) for the detection of Tau (4-repeat isoform RD4). pricing
MABN162 Anti-Tau, a.a. 210-241 Antibody, clone Tau-5 Detect Tau, a.a. 210-241, clone Tau-5 using this Anti-Tau, a.a. 210-241 Antibody, clone Tau-5 validated for use in Western Blotting. pricing
ABN1703 Anti-Tau, AEP-cleaved (N368) Antibody This Anti-Tau, AEP-cleaved (N368) Antibody is validated for use in Western Blotting for the detection of AEP-cleaved Tau N-terminal fragment (N368). pricing
MAB361 Anti-Tau Antibody, a.a. 210-241, clone Tau-5 Anti-Tau Antibody, a.a. 210-241, clone Tau-5 detects level of Tau & has been published & validated for use in IH & WB. pricing
MAB5430 Anti-Tau Antibody, Caspase Cleaved (truncated at Asp421) Anti-Tau Antibody, Caspase Cleaved (truncated at Asp421) is an antibody against Tau for use in ELISA, WB, IH. pricing
MAB5430-C Anti-Tau Antibody, Cleaved (D421), clone Tau-C3, Ascites Free Anti-Tau Antibody, Cleaved (D421), clone Tau-C3, Ascites Free is an antibody against Tau for use in Immunohistochemistry (Paraffin), Immunofluorescence, Western Blotting, Immunocytochemistry. pricing
05-348 Anti-Tau Antibody, clone 5E2 Detect Tau using this Anti-Tau Antibody, clone 5E2 validated for use in WB, IH. pricing
MAB3420-AF555 Anti-Tau Antibody, clone PC1C6, Alexa Fluor® 555 Conjugate This Anti-Tau Antibody, clone PC1C6, Alexa Fluor® 555 Conjugate is validated for use in Immunofluorescence, Immunocytochemistry for the detection of Tau. pricing
MABN827 Anti-Tau Antibody, clone T49 (Not human) Anti-Tau Antibody, clone T49 (Not human) is an antibody against Tau for use in Western Blotting and Immunohistochemistry. pricing
MABN2406 Anti-Tau Antibody, clone TNT-2 Anti-Tau Antibody, clone TNT-2, Cat. No. MABN2406, is a highly specific mouse monoclonal antibody that targets Tau and has been tested in ELISA, Immunofluorescence, Immunohistochemistry, and Western Blotting. pricing
MABN819 Anti-Tau Antibody, oligomeric Antibody, clone TOMA-1 Anti-Tau, oligomeric, clone TOMA-1, Cat. No. MABN819, is amouse monoclonal antibody that targets tau oligomers and has been tested in Dot Blot, ELISA, Immunofluorescence, Immunohistochemistry, Neutralization, and Western Blotting applications. pricing
MABN471 Anti-Tau Antibody, PAD, clone TNT-1 Anti-Tau, PAD, clone TNT-1 detects levels of Tau proteins & has been published & validated for use in WB, IHC, IF & ELISA. pricing
MAB5450 Anti-Tau Antibody, phosphoThreonine 231, clone PHF-6 Anti-Tau Antibody, phosphoThreonine 231, clone PHF-6 is an antibody against Tau for use in ELISA & WB. pricing
AB9674 Anti-Tau phospho Serine 199/202 Antibody Detect Tau phospho Serine 199/202 using this Anti-Tau phospho Serine 199/202 Antibody validated for use in WB. pricing
AB9652 Anti-Tau phospho Serine 199 Antibody Anti-Tau phospho Serine 199 Antibody is an antibody against Tau phospho Serine 199 for use in WB. pricing
AB9672 Anti-Tau phospho Serine 214 Antibody This Anti-Tau phospho Serine 214 Antibody is validated for use in WB for the detection of Tau phospho Serine 214. pricing
AB9656 Anti-Tau phospho Serine 262 Antibody Detect Tau phospho Serine 262 using this Anti-Tau phospho Serine 262 Antibody validated for use in WB. pricing
AB9658 Anti-Tau phospho Serine 396 Antibody Anti-Tau phospho Serine 396 Antibody detects level of Tau phospho Serine 396 & has been published & validated for use in WB. pricing
AB9660 Anti-Tau phospho Serine 404 Antibody Anti-Tau phospho Serine 404 Antibody is an antibody against Tau phospho Serine 404 for use in WB. pricing
AB9662 Anti-Tau phospho Serine 409 Antibody This Anti-Tau phospho Serine 409 Antibody is validated for use in WB for the detection of Tau phospho Serine 409. pricing
AB9676 Anti-Tau phospho Threonine 205 Antibody This Anti-Tau phospho Threonine 205 Antibody is validated for use in WB for the detection of Tau phospho Threonine 205. pricing
AB9688 Anti-Tau phospho Threonine 212 Antibody Detect Tau phospho Threonine 212 using this Anti-Tau phospho Threonine 212 Antibody validated for use in WB. pricing
AB9668 Anti-Tau phospho Threonine 231 Antibody Anti-Tau phospho Threonine 231 Antibody detects level of Tau phospho Threonine 231 & has been published & validated for use in WB. pricing
ABN454-I Anti-Tau (T22) Antibody, oligomeric This rabbit polyclonal Anti-Tau (T22), oligomeric, Cat. No. ABN454-I detects levels of Tau oligomers, and has been published and validated for use in Dot Blot, Immunofluorescence, Immunohistochemistry and Western Blotting. pricing
ABN454 Anti-Tau (T22), oligomeric Antibody This Anti-Tau (T22) antibody, oligomeric is validated for use in Dot Blot, ELISA, Immunofluorescence, Immunohistochemistry, Immunoprecipitation, Neutralization, and Western blotting. pricing
AG952 Tau-381, recombinant human pricing
AG960 Tau-441, recombinant human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123066 Rosetta Predictions human pricing
NM_001123067 Rosetta Predictions human pricing
NM_005910 Rosetta Predictions human pricing
NM_016834 Rosetta Predictions human pricing
NM_016835 Rosetta Predictions human pricing
NM_016841 Rosetta Predictions human pricing
NM_017212 Rosetta Predictions rat pricing
NM_001038609 Rosetta Predictions mouse pricing
NM_010838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327697 predicted 693
2 SASI_Hs02_00327698 predicted 2346
3 SASI_Hs02_00327699 predicted 2288
4 SASI_Hs02_00327700 predicted 490
5 SASI_Hs02_00327701 predicted 2370
6 SASI_Hs02_00327702 predicted 2253
7 SASI_Hs02_00327703 predicted 1174
8 SASI_Hs02_00327704 predicted 1650
9 SASI_Hs02_00327705 predicted 497
10 SASI_Hs02_00327706 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327707 predicted 1137
2 SASI_Hs02_00327708 predicted 1137
3 SASI_Hs02_00327709 predicted 1199
4 SASI_Hs02_00327710 predicted 1088
5 SASI_Hs02_00327711 predicted 496
6 SASI_Hs02_00327712 predicted 1669
7 SASI_Hs02_00327713 predicted 1279
8 SASI_Hs02_00327714 predicted 1740
9 SASI_Hs02_00327715 predicted 401
10 SASI_Hs02_00327716 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117169 predicted 1223
2 SASI_Hs02_00340525 predicted 1227
3 SASI_Hs02_00340526 predicted 1286
4 SASI_Hs01_00117170 predicted 1176
5 SASI_Hs01_00117171 predicted 497
6 SASI_Hs01_00117172 predicted 1754
7 SASI_Hs01_00117173 predicted 1368
8 SASI_Hs01_00117174 predicted 1822
9 SASI_Hs01_00117175 predicted 402
10 SASI_Hs01_00117176 predicted 1248
11 SASI_Hs01_00117168 predicted 2042
12 SASI_Hs01_00117177 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349898 predicted 1948
2 SASI_Hs01_00191466 predicted 1051
3 SASI_Hs02_00349899 predicted 1111
4 SASI_Hs01_00191468 predicted 1007
5 SASI_Hs01_00191469 predicted 1577
6 SASI_Hs01_00191470 predicted 1199
7 SASI_Hs01_00191471 predicted 1649
8 SASI_Hs01_00191472 predicted 400
9 SASI_Hs01_00191473 predicted 1071
10 SASI_Hs01_00191474 predicted 1574
11 SASI_Hs01_00191467 predicted 975
12 SASI_Hs01_00191475 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066828 predicted 698
2 SASI_Hs01_00066829 predicted 2292
3 SASI_Hs02_00349900 predicted 2233
4 SASI_Hs01_00066830 predicted 1122
5 SASI_Hs01_00066831 predicted 490
6 SASI_Hs01_00066832 predicted 2316
7 SASI_Hs01_00066833 predicted 2197
8 SASI_Hs01_00066834 predicted 1172
9 SASI_Hs01_00066835 predicted 1643
10 SASI_Hs01_00066836 predicted 492
11 SASI_Hs01_00066837 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349909 predicted 1848
2 SASI_Hs01_00195603 predicted 956
3 SASI_Hs02_00349910 predicted 1021
4 SASI_Hs01_00195605 predicted 1484
5 SASI_Hs01_00195606 predicted 1106
6 SASI_Hs01_00195607 predicted 1562
7 SASI_Hs01_00195608 predicted 396
8 SASI_Hs01_00195609 predicted 966
9 SASI_Hs01_00195610 predicted 1525
10 SASI_Hs01_00195611 predicted 986
11 SASI_Hs01_00195604 predicted 1027
12 SASI_Hs01_00195612 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054888 predicted 217
2 SASI_Rn01_00054889 predicted 980
3 SASI_Rn02_00261574 predicted 1026
4 SASI_Rn01_00054890 predicted 654
5 SASI_Rn01_00054891 predicted 296
6 SASI_Rn01_00054892 predicted 801
7 SASI_Rn01_00054893 predicted 811
8 SASI_Rn01_00054894 predicted 961
9 SASI_Rn01_00054895 predicted 852
10 SASI_Rn02_00261575 predicted 1096
11 SASI_Rn01_00054896 predicted 276
12 SASI_Rn01_00054897 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089621 predicted 1199
2 SASI_Mm01_00089622 predicted 1020
3 SASI_Mm01_00089623 predicted 1190
4 SASI_Mm01_00089625 predicted 1107
5 SASI_Mm01_00089627 predicted 1118
6 SASI_Mm01_00089628 predicted 1062
7 SASI_Mm01_00089629 predicted 1010
8 SASI_Mm01_00089630 predicted 922
9 SASI_Mm02_00289621 predicted 966
10 SASI_Mm02_00289622 predicted 925
11 SASI_Mm01_00089624 predicted 1213
12 SASI_Mm01_00089626 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136823 predicted 1032
2 SASI_Mm01_00136824 predicted 844
3 SASI_Mm01_00136825 predicted 1012
4 SASI_Mm01_00136827 predicted 930
5 SASI_Mm01_00136829 predicted 940
6 SASI_Mm01_00136830 predicted 887
7 SASI_Mm01_00136831 predicted 836
8 SASI_Mm01_00136832 predicted 746
9 SASI_Mm02_00319475 predicted 792
10 SASI_Mm02_00319476 predicted 749
11 SASI_Mm01_00136826 predicted 1035
12 SASI_Mm01_00136828 predicted 1136
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010838
MAPT MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein tau
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-313s1c1
Sequence:CCGGACAGGAAATGACGAGAAGAAACTCGAGTTTCTTCTCGTCATTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-958s1c1
Sequence:CCGGGACAGAGTCCAGTCGAAGATTCTCGAGAATCTTCGACTGGACTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-1080s1c1
Sequence:CCGGTGGAGCAGAAATTGTGTATAACTCGAGTTATACACAATTTCTGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-672s1c1
Sequence:CCGGCCTAAAGAATGTAGGGTCGAACTCGAGTTCGACCCTACATTCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-888s1c1
Sequence:CCGGGTTAGGGAACATCCATCACAACTCGAGTTGTGATGGATGTTCCCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010838
MAPT MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein tau
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-313s1c1
Sequence:CCGGACAGGAAATGACGAGAAGAAACTCGAGTTTCTTCTCGTCATTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-958s1c1
Sequence:CCGGGACAGAGTCCAGTCGAAGATTCTCGAGAATCTTCGACTGGACTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-1080s1c1
Sequence:CCGGTGGAGCAGAAATTGTGTATAACTCGAGTTATACACAATTTCTGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-672s1c1
Sequence:CCGGCCTAAAGAATGTAGGGTCGAACTCGAGTTCGACCCTACATTCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-888s1c1
Sequence:CCGGGTTAGGGAACATCCATCACAACTCGAGTTGTGATGGATGTTCCCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010838
MAPT MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein tau
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-313s1c1
Sequence:CCGGACAGGAAATGACGAGAAGAAACTCGAGTTTCTTCTCGTCATTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-958s1c1
Sequence:CCGGGACAGAGTCCAGTCGAAGATTCTCGAGAATCTTCGACTGGACTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-1080s1c1
Sequence:CCGGTGGAGCAGAAATTGTGTATAACTCGAGTTATACACAATTTCTGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-672s1c1
Sequence:CCGGCCTAAAGAATGTAGGGTCGAACTCGAGTTCGACCCTACATTCTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010838.2-888s1c1
Sequence:CCGGGTTAGGGAACATCCATCACAACTCGAGTTGTGATGGATGTTCCCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005910
MAPT MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein tau
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005910.2-1148s1c1
Sequence:CCGGCAGTGTGCAAATAGTCTACAACTCGAGTTGTAGACTATTTGCACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005910.2-1199s1c1
Sequence:CCGGGTGTGGCTCATTAGGCAACATCTCGAGATGTTGCCTAATGAGCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005910.2-1097s1c1
Sequence:CCGGCCAGTCCAAGTGTGGCTCAAACTCGAGTTTGAGCCACACTTGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005910.2-1994s1c1
Sequence:CCGGGCAGCAACAAAGGATTTGAAACTCGAGTTTCAAATCCTTTGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005910.4-1407s21c1
Sequence:CCGGGTCCCTGGCGGAGGAAATAAACTCGAGTTTATTTCCTCCGCCAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005910.4-1363s21c1
Sequence:CCGGACAGAGTCCAGTCGAAGATTGCTCGAGCAATCTTCGACTGGACTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005910.4-1134s21c1
Sequence:CCGGGGCGGGAAGGTGCAGATAATTCTCGAGAATTATCTGCACCTTCCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005910
MAPT MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein tau
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005910.2-1148s1c1
Sequence:CCGGCAGTGTGCAAATAGTCTACAACTCGAGTTGTAGACTATTTGCACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005910.2-1199s1c1
Sequence:CCGGGTGTGGCTCATTAGGCAACATCTCGAGATGTTGCCTAATGAGCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005910.2-1097s1c1
Sequence:CCGGCCAGTCCAAGTGTGGCTCAAACTCGAGTTTGAGCCACACTTGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005910.2-1994s1c1
Sequence:CCGGGCAGCAACAAAGGATTTGAAACTCGAGTTTCAAATCCTTTGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005910.4-1407s21c1
Sequence:CCGGGTCCCTGGCGGAGGAAATAAACTCGAGTTTATTTCCTCCGCCAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005910.4-1363s21c1
Sequence:CCGGACAGAGTCCAGTCGAAGATTGCTCGAGCAATCTTCGACTGGACTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005910.4-1134s21c1
Sequence:CCGGGGCGGGAAGGTGCAGATAATTCTCGAGAATTATCTGCACCTTCCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005910
MAPT MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein tau
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005910.2-1148s1c1
Sequence:CCGGCAGTGTGCAAATAGTCTACAACTCGAGTTGTAGACTATTTGCACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005910.2-1199s1c1
Sequence:CCGGGTGTGGCTCATTAGGCAACATCTCGAGATGTTGCCTAATGAGCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005910.2-1097s1c1
Sequence:CCGGCCAGTCCAAGTGTGGCTCAAACTCGAGTTTGAGCCACACTTGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005910.2-1994s1c1
Sequence:CCGGGCAGCAACAAAGGATTTGAAACTCGAGTTTCAAATCCTTTGTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005910.4-1407s21c1
Sequence:CCGGGTCCCTGGCGGAGGAAATAAACTCGAGTTTATTTCCTCCGCCAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005910.4-1363s21c1
Sequence:CCGGACAGAGTCCAGTCGAAGATTGCTCGAGCAATCTTCGACTGGACTCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005910.4-1134s21c1
Sequence:CCGGGGCGGGAAGGTGCAGATAATTCTCGAGAATTATCTGCACCTTCCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)