EMAIL THIS PAGE TO A FRIEND

MARC1

mitochondrial amidoxime reducing component 1

120 Gene Product Result for
Synonyms: MOSC1
Gene ID:
Mouse(66112) mitochondrial amidoxime reducing component 1
Rat(690745) mitochondrial amidoxime reducing component 1
dog(488601) mitochondrial amidoxime reducing component 1
cow(537028) mitochondrial amidoxime reducing component 1
domestic cat(101099775) mitochondrial amidoxime reducing component 1
sheep(101123651) mitochondrial amidoxime reducing component 1
naked mole-rat(101713580) mitochondrial amidoxime reducing component 1
domestic guinea pig(100715718) mitochondrial amidoxime reducing component 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081361 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081361 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081361 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022746 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029031 MISSION® esiRNA esiRNA human MOSC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022746 Rosetta Predictions human pricing
XM_001075480 Rosetta Predictions rat pricing
NM_001081361 Rosetta Predictions mouse pricing
XM_129663 Rosetta Predictions mouse pricing
XM_899542 Rosetta Predictions mouse pricing
XM_899547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060654 predicted 471
2 SASI_Hs01_00060655 predicted 903
3 SASI_Hs01_00060656 predicted 437
4 SASI_Hs01_00060657 predicted 687
5 SASI_Hs01_00060659 predicted 944
6 SASI_Hs01_00060660 predicted 1020
7 SASI_Hs01_00060661 predicted 599
8 SASI_Hs01_00060662 predicted 632
9 SASI_Hs01_00060663 predicted 1083
10 SASI_Hs02_00356002 predicted 885
11 SASI_Hs01_00060658 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349904 predicted 504
2 SASI_Rn02_00349905 predicted 504
3 SASI_Rn02_00349906 predicted 327
4 SASI_Rn02_00349907 predicted 473
5 SASI_Rn02_00349908 predicted 327
6 SASI_Rn02_00349909 predicted 333
7 SASI_Rn02_00349910 predicted 356
8 SASI_Rn02_00349911 predicted 412
9 SASI_Rn02_00349912 predicted 343
10 SASI_Rn02_00349913 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297661 predicted 1484
2 SASI_Mm02_00297662 predicted 816
3 SASI_Mm02_00297663 predicted 1607
4 SASI_Mm02_00297664 predicted 1609
5 SASI_Mm02_00297665 predicted 762
6 SASI_Mm02_00297666 predicted 1689
7 SASI_Mm02_00297667 predicted 1466
8 SASI_Mm02_00297668 predicted 937
9 SASI_Mm02_00297669 predicted 1597
10 SASI_Mm02_00297670 predicted 1617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266444 predicted 1714
2 SASI_Mm01_00266445 predicted 886
3 SASI_Mm01_00266446 predicted 896
4 SASI_Mm01_00266447 predicted 1604
5 SASI_Mm01_00266448 predicted 808
6 SASI_Mm01_00266449 predicted 1683
7 SASI_Mm01_00266450 predicted 1462
8 SASI_Mm01_00266451 predicted 935
9 SASI_Mm01_00266452 predicted 1474
10 SASI_Mm01_00266453 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244201 predicted 1491
2 SASI_Mm01_00244202 predicted 820
3 SASI_Mm01_00244203 predicted 1608
4 SASI_Mm01_00244204 predicted 1613
5 SASI_Mm01_00244205 predicted 768
6 SASI_Mm01_00244206 predicted 772
7 SASI_Mm01_00244207 predicted 1693
8 SASI_Mm01_00244208 predicted 1475
9 SASI_Mm01_00244209 predicted 943
10 SASI_Mm01_00244210 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225364 predicted 1284
2 SASI_Mm01_00225365 predicted 1210
3 SASI_Mm01_00225366 predicted 414
4 SASI_Mm01_00225367 predicted 602
5 SASI_Mm01_00225368 predicted 1207
6 SASI_Mm01_00225369 predicted 543
7 SASI_Mm01_00225370 predicted 532
8 SASI_Mm01_00225371 predicted 1298
9 SASI_Mm01_00225372 predicted 1074
10 SASI_Mm01_00225373 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081361
MARC1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial amidoxime reducing component 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-939s21c1
Sequence:CCGGGCGTTTATGCTGAGGATTCTTCTCGAGAAGAATCCTCAGCATAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-975s21c1
Sequence:CCGGTTGGAGATGTGGAACTGAAACCTCGAGGTTTCAGTTCCACATCTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-957s21c1
Sequence:CCGGCTTGGAACGAGGTTCTCATTGCTCGAGCAATGAGAACCTCGTTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-1063s21c1
Sequence:CCGGGGAGCCTCTGGAAACACTGAACTCGAGTTCAGTGTTTCCAGAGGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-991s21c1
Sequence:CCGGGAAACGGGTGATGGCTTGTACCTCGAGGTACAAGCCATCACCCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081361
MARC1 MISSION shRNA shRNA Plasmid DNA
mitochondrial amidoxime reducing component 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-939s21c1
Sequence:CCGGGCGTTTATGCTGAGGATTCTTCTCGAGAAGAATCCTCAGCATAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-975s21c1
Sequence:CCGGTTGGAGATGTGGAACTGAAACCTCGAGGTTTCAGTTCCACATCTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-957s21c1
Sequence:CCGGCTTGGAACGAGGTTCTCATTGCTCGAGCAATGAGAACCTCGTTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-1063s21c1
Sequence:CCGGGGAGCCTCTGGAAACACTGAACTCGAGTTCAGTGTTTCCAGAGGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-991s21c1
Sequence:CCGGGAAACGGGTGATGGCTTGTACCTCGAGGTACAAGCCATCACCCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081361
MARC1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial amidoxime reducing component 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-939s21c1
Sequence:CCGGGCGTTTATGCTGAGGATTCTTCTCGAGAAGAATCCTCAGCATAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-975s21c1
Sequence:CCGGTTGGAGATGTGGAACTGAAACCTCGAGGTTTCAGTTCCACATCTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-957s21c1
Sequence:CCGGCTTGGAACGAGGTTCTCATTGCTCGAGCAATGAGAACCTCGTTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-1063s21c1
Sequence:CCGGGGAGCCTCTGGAAACACTGAACTCGAGTTCAGTGTTTCCAGAGGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081361.1-991s21c1
Sequence:CCGGGAAACGGGTGATGGCTTGTACCTCGAGGTACAAGCCATCACCCGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022746
MARC1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial amidoxime reducing component 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022746.2-1286s1c1
Sequence:CCGGCCCGTTTAACTGATTATGGAACTCGAGTTCCATAATCAGTTAAACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022746.2-1045s1c1
Sequence:CCGGCCTGGAATATTAGATGCCTTTCTCGAGAAAGGCATCTAATATTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022746.2-753s1c1
Sequence:CCGGGCGATGTCTATGCAGAGGATTCTCGAGAATCCTCTGCATAGACATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022746.2-401s1c1
Sequence:CCGGGCCTACACAAAGGACCTACTACTCGAGTAGTAGGTCCTTTGTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-817s1c1
Sequence:CCGGGATGGCTTGTTCCAGATGCATCTCGAGATGCATCTGGAACAAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-645s1c1
Sequence:CCGGCCAGCCCATTCTTGATCCTTTCTCGAGAAAGGATCAAGAATGGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-441s1c1
Sequence:CCGGCCACAAATGCAGTGCACAAGTCTCGAGACTTGTGCACTGCATTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-197s1c1
Sequence:CCGGCTCTGGATCTACCCTGTGAAACTCGAGTTTCACAGGGTAGATCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022746.2-948s1c1
Sequence:CCGGCACCACTCTTTGGGCAGTATTCTCGAGAATACTGCCCAAAGAGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-439s1c1
Sequence:CCGGCACCACAAATGCAGTGCACAACTCGAGTTGTGCACTGCATTTGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022746.2-1446s1c1
Sequence:CCGGCCTGTTCATGAGGTACGCAATCTCGAGATTGCGTACCTCATGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022746
MARC1 MISSION shRNA shRNA Plasmid DNA
mitochondrial amidoxime reducing component 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022746.2-1286s1c1
Sequence:CCGGCCCGTTTAACTGATTATGGAACTCGAGTTCCATAATCAGTTAAACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022746.2-1045s1c1
Sequence:CCGGCCTGGAATATTAGATGCCTTTCTCGAGAAAGGCATCTAATATTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022746.2-753s1c1
Sequence:CCGGGCGATGTCTATGCAGAGGATTCTCGAGAATCCTCTGCATAGACATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022746.2-401s1c1
Sequence:CCGGGCCTACACAAAGGACCTACTACTCGAGTAGTAGGTCCTTTGTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-817s1c1
Sequence:CCGGGATGGCTTGTTCCAGATGCATCTCGAGATGCATCTGGAACAAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-645s1c1
Sequence:CCGGCCAGCCCATTCTTGATCCTTTCTCGAGAAAGGATCAAGAATGGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-441s1c1
Sequence:CCGGCCACAAATGCAGTGCACAAGTCTCGAGACTTGTGCACTGCATTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-197s1c1
Sequence:CCGGCTCTGGATCTACCCTGTGAAACTCGAGTTTCACAGGGTAGATCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022746.2-948s1c1
Sequence:CCGGCACCACTCTTTGGGCAGTATTCTCGAGAATACTGCCCAAAGAGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-439s1c1
Sequence:CCGGCACCACAAATGCAGTGCACAACTCGAGTTGTGCACTGCATTTGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022746.2-1446s1c1
Sequence:CCGGCCTGTTCATGAGGTACGCAATCTCGAGATTGCGTACCTCATGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022746
MARC1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial amidoxime reducing component 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022746.2-1286s1c1
Sequence:CCGGCCCGTTTAACTGATTATGGAACTCGAGTTCCATAATCAGTTAAACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022746.2-1045s1c1
Sequence:CCGGCCTGGAATATTAGATGCCTTTCTCGAGAAAGGCATCTAATATTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022746.2-753s1c1
Sequence:CCGGGCGATGTCTATGCAGAGGATTCTCGAGAATCCTCTGCATAGACATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022746.2-401s1c1
Sequence:CCGGGCCTACACAAAGGACCTACTACTCGAGTAGTAGGTCCTTTGTGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-817s1c1
Sequence:CCGGGATGGCTTGTTCCAGATGCATCTCGAGATGCATCTGGAACAAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-645s1c1
Sequence:CCGGCCAGCCCATTCTTGATCCTTTCTCGAGAAAGGATCAAGAATGGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-441s1c1
Sequence:CCGGCCACAAATGCAGTGCACAAGTCTCGAGACTTGTGCACTGCATTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-197s1c1
Sequence:CCGGCTCTGGATCTACCCTGTGAAACTCGAGTTTCACAGGGTAGATCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022746.2-948s1c1
Sequence:CCGGCACCACTCTTTGGGCAGTATTCTCGAGAATACTGCCCAAAGAGTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022746.2-439s1c1
Sequence:CCGGCACCACAAATGCAGTGCACAACTCGAGTTGTGCACTGCATTTGTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022746.2-1446s1c1
Sequence:CCGGCCTGTTCATGAGGTACGCAATCTCGAGATTGCGTACCTCATGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)