EMAIL THIS PAGE TO A FRIEND

MARC2

mitochondrial amidoxime reducing component 2

55 Gene Product Result for
Synonyms: MOSC2 RP11-270A6.1
Gene ID:
Mouse(67247) mitochondrial amidoxime reducing component 2
Rat(171451) mitochondrial amidoxime reducing component 2
domestic guinea pig(100733997) mitochondrial amidoxime reducing component 2
naked mole-rat(101712958) mitochondrial amidoxime reducing component 2
sheep(101123395) mitochondrial amidoxime reducing component 2
chicken(428563) mitochondrial amidoxime reducing component 2
domestic cat(101099524) mitochondrial amidoxime reducing component 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017898 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017898 Rosetta Predictions human pricing
NM_134410 Rosetta Predictions rat pricing
NM_133684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051917 predicted 725
2 SASI_Hs02_00350873 predicted 723
3 SASI_Hs01_00051918 predicted 1091
4 SASI_Hs01_00051920 predicted 683
5 SASI_Hs01_00051921 predicted 1295
6 SASI_Hs01_00051922 predicted 1285
7 SASI_Hs02_00350874 predicted 954
8 SASI_Hs01_00051923 predicted 1252
9 SASI_Hs01_00051924 predicted 963
10 SASI_Hs01_00051925 predicted 1110
11 SASI_Hs01_00051919 predicted 684
12 SASI_Hs01_00051926 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091359 predicted 942
2 SASI_Rn02_00268006 predicted 707
3 SASI_Rn01_00091360 predicted 1056
4 SASI_Rn01_00091361 predicted 532
5 SASI_Rn01_00091362 predicted 398
6 SASI_Rn01_00091363 predicted 888
7 SASI_Rn01_00091364 predicted 233
8 SASI_Rn01_00091365 predicted 267
9 SASI_Rn01_00091366 predicted 643
10 SASI_Rn01_00091367 predicted 920
11 SASI_Rn01_00091368 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338644 predicted 468
2 SASI_Mm01_00058370 predicted 719
3 SASI_Mm01_00058371 predicted 534
4 SASI_Mm01_00058372 predicted 597
5 SASI_Mm01_00058373 predicted 971
6 SASI_Mm01_00058374 predicted 1017
7 SASI_Mm01_00058375 predicted 495
8 SASI_Mm01_00058376 predicted 934
9 SASI_Mm01_00058377 predicted 1031
10 SASI_Mm01_00058378 predicted 1103
11 SASI_Mm01_00058379 predicted 1144
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133684
VALIDATED
MARC2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial amidoxime reducing component 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133684.3-376s21c1
Sequence:CCGGATCACCCTGGAGAACAATTACCTCGAGGTAATTGTTCTCCAGGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133684.2-1154s1c1
Sequence:CCGGCGCCTTGACTTAATTCAAGAACTCGAGTTCTTGAATTAAGTCAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133684.2-479s1c1
Sequence:CCGGCTGTTTGGTCTCGACATCAAACTCGAGTTTGATGTCGAGACCAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133684.3-441s21c1
Sequence:CCGGCAAGCTCCCTTCTTCGAATAACTCGAGTTATTCGAAGAAGGGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133684.3-723s21c1
Sequence:CCGGGAAAGTGAAGATGGAATATTTCTCGAGAAATATTCCATCTTCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133684.3-1266s21c1
Sequence:CCGGTGAATGCTACACCCGCTATTACTCGAGTAATAGCGGGTGTAGCATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133684
VALIDATED
MARC2 MISSION shRNA shRNA Plasmid DNA
mitochondrial amidoxime reducing component 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133684.3-376s21c1
Sequence:CCGGATCACCCTGGAGAACAATTACCTCGAGGTAATTGTTCTCCAGGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133684.2-1154s1c1
Sequence:CCGGCGCCTTGACTTAATTCAAGAACTCGAGTTCTTGAATTAAGTCAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133684.2-479s1c1
Sequence:CCGGCTGTTTGGTCTCGACATCAAACTCGAGTTTGATGTCGAGACCAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133684.3-441s21c1
Sequence:CCGGCAAGCTCCCTTCTTCGAATAACTCGAGTTATTCGAAGAAGGGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133684.3-723s21c1
Sequence:CCGGGAAAGTGAAGATGGAATATTTCTCGAGAAATATTCCATCTTCACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133684.3-1266s21c1
Sequence:CCGGTGAATGCTACACCCGCTATTACTCGAGTAATAGCGGGTGTAGCATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133684
VALIDATED
MARC2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial amidoxime reducing component 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133684.3-376s21c1
Sequence:CCGGATCACCCTGGAGAACAATTACCTCGAGGTAATTGTTCTCCAGGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133684.2-1154s1c1
Sequence:CCGGCGCCTTGACTTAATTCAAGAACTCGAGTTCTTGAATTAAGTCAAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133684.2-479s1c1
Sequence:CCGGCTGTTTGGTCTCGACATCAAACTCGAGTTTGATGTCGAGACCAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133684.3-441s21c1
Sequence:CCGGCAAGCTCCCTTCTTCGAATAACTCGAGTTATTCGAAGAAGGGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133684.3-723s21c1
Sequence:CCGGGAAAGTGAAGATGGAATATTTCTCGAGAAATATTCCATCTTCACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133684.3-1266s21c1
Sequence:CCGGTGAATGCTACACCCGCTATTACTCGAGTAATAGCGGGTGTAGCATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017898
VALIDATED
MARC2 MISSION shRNA Bacterial Glycerol Stock
mitochondrial amidoxime reducing component 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017898.3-646s21c1
Sequence:CCGGATATTTGGCCTTGACATTAAACTCGAGTTTAATGTCAAGGCCAAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017898.3-952s21c1
Sequence:CCGGACCTGGGATGAACTCCTAATTCTCGAGAATTAGGAGTTCATCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017898.3-1375s1c1
Sequence:CCGGGCTCCAGGTTAATGCAAGGAACTCGAGTTCCTTGCATTAACCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-537s1c1
Sequence:CCGGCATCTCCATCATTTATGAGAACTCGAGTTCTCATAAATGATGGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-961s1c1
Sequence:CCGGGAACTCCTAATTGGTAGTGTACTCGAGTACACTACCAATTAGGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017898.3-1286s1c1
Sequence:CCGGCGATACATCAGCAAATCCTTACTCGAGTAAGGATTTGCTGATGTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-620s1c1
Sequence:CCGGCCTCAAACAAACTCCACAACTCTCGAGAGTTGTGGAGTTTGTTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017898.3-532s21c1
Sequence:GTACCGGGTGCTCATCTCCATCATTTATCTCGAGATAAATGATGGAGATGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017898.3-897s21c1
Sequence:CCGGGGAGAATTTCAGGCCAAATATCTCGAGATATTTGGCCTGAAATTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017898.3-1279s1c1
Sequence:CCGGGCAGCAACGATACATCAGCAACTCGAGTTGCTGATGTATCGTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-642s1c1
Sequence:CCGGCAGGATATTTGGCCTTGACATCTCGAGATGTCAAGGCCAAATATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-731s1c1
Sequence:CCGGGATTGGTTCAATTTGAGACAACTCGAGTTGTCTCAAATTGAACCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017898.3-1216s21c1
Sequence:CCGGATGGATCCACTAGGGTGATATCTCGAGATATCACCCTAGTGGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017898
VALIDATED
MARC2 MISSION shRNA shRNA Plasmid DNA
mitochondrial amidoxime reducing component 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017898.3-646s21c1
Sequence:CCGGATATTTGGCCTTGACATTAAACTCGAGTTTAATGTCAAGGCCAAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017898.3-952s21c1
Sequence:CCGGACCTGGGATGAACTCCTAATTCTCGAGAATTAGGAGTTCATCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017898.3-1375s1c1
Sequence:CCGGGCTCCAGGTTAATGCAAGGAACTCGAGTTCCTTGCATTAACCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-537s1c1
Sequence:CCGGCATCTCCATCATTTATGAGAACTCGAGTTCTCATAAATGATGGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-961s1c1
Sequence:CCGGGAACTCCTAATTGGTAGTGTACTCGAGTACACTACCAATTAGGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017898.3-1286s1c1
Sequence:CCGGCGATACATCAGCAAATCCTTACTCGAGTAAGGATTTGCTGATGTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-620s1c1
Sequence:CCGGCCTCAAACAAACTCCACAACTCTCGAGAGTTGTGGAGTTTGTTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017898.3-532s21c1
Sequence:GTACCGGGTGCTCATCTCCATCATTTATCTCGAGATAAATGATGGAGATGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017898.3-897s21c1
Sequence:CCGGGGAGAATTTCAGGCCAAATATCTCGAGATATTTGGCCTGAAATTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017898.3-1279s1c1
Sequence:CCGGGCAGCAACGATACATCAGCAACTCGAGTTGCTGATGTATCGTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-642s1c1
Sequence:CCGGCAGGATATTTGGCCTTGACATCTCGAGATGTCAAGGCCAAATATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-731s1c1
Sequence:CCGGGATTGGTTCAATTTGAGACAACTCGAGTTGTCTCAAATTGAACCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017898.3-1216s21c1
Sequence:CCGGATGGATCCACTAGGGTGATATCTCGAGATATCACCCTAGTGGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017898
VALIDATED
MARC2 MISSION shRNA Lentiviral Transduction Particles
mitochondrial amidoxime reducing component 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017898.3-646s21c1
Sequence:CCGGATATTTGGCCTTGACATTAAACTCGAGTTTAATGTCAAGGCCAAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017898.3-952s21c1
Sequence:CCGGACCTGGGATGAACTCCTAATTCTCGAGAATTAGGAGTTCATCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017898.3-1375s1c1
Sequence:CCGGGCTCCAGGTTAATGCAAGGAACTCGAGTTCCTTGCATTAACCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-537s1c1
Sequence:CCGGCATCTCCATCATTTATGAGAACTCGAGTTCTCATAAATGATGGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-961s1c1
Sequence:CCGGGAACTCCTAATTGGTAGTGTACTCGAGTACACTACCAATTAGGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017898.3-1286s1c1
Sequence:CCGGCGATACATCAGCAAATCCTTACTCGAGTAAGGATTTGCTGATGTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-620s1c1
Sequence:CCGGCCTCAAACAAACTCCACAACTCTCGAGAGTTGTGGAGTTTGTTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017898.3-532s21c1
Sequence:GTACCGGGTGCTCATCTCCATCATTTATCTCGAGATAAATGATGGAGATGAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017898.3-897s21c1
Sequence:CCGGGGAGAATTTCAGGCCAAATATCTCGAGATATTTGGCCTGAAATTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017898.3-1279s1c1
Sequence:CCGGGCAGCAACGATACATCAGCAACTCGAGTTGCTGATGTATCGTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-642s1c1
Sequence:CCGGCAGGATATTTGGCCTTGACATCTCGAGATGTCAAGGCCAAATATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017898.3-731s1c1
Sequence:CCGGGATTGGTTCAATTTGAGACAACTCGAGTTGTCTCAAATTGAACCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017898.3-1216s21c1
Sequence:CCGGATGGATCCACTAGGGTGATATCTCGAGATATCACCCTAGTGGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)