EMAIL THIS PAGE TO A FRIEND

MARCH10

membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase

116 Gene Product Result for
Synonyms: MARCH-X RNF190
UniProtKB ID: Q8NA82, D3DU09, Q8IYS7, Q8N7Z7
Gene ID:
Human(162333) Summary: MARCH10 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Morokuma et al., 2007 [PubMed 17604280]
Mouse(632687) membrane-associated ring finger (C3HC4) 10
Rat(303596) membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
domestic guinea pig(100714929) membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
naked mole-rat(101699102) membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
sheep(101123389) membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
dog(490914) membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
Horse(100064936) membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
cow(540263) membrane-associated ring finger (C3HC4) 10
domestic cat(101082356) membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150131 MISSION® esiRNA esiRNA human MARCH10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100875 Rosetta Predictions human pricing
NM_152598 Rosetta Predictions human pricing
NM_001013973 Rosetta Predictions rat pricing
NM_001039242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322427 predicted 481
2 SASI_Hs02_00322428 predicted 1793
3 SASI_Hs02_00322429 predicted 2351
4 SASI_Hs02_00322430 predicted 1842
5 SASI_Hs02_00322431 predicted 2342
6 SASI_Hs02_00322432 predicted 469
7 SASI_Hs02_00322433 predicted 667
8 SASI_Hs02_00322434 predicted 1741
9 SASI_Hs02_00322435 predicted 1933
10 SASI_Hs02_00322436 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089449 predicted 532
2 SASI_Hs02_00366442 predicted 1840
3 SASI_Hs01_00089452 predicted 2406
4 SASI_Hs01_00089450 predicted 1887
5 SASI_Hs01_00089453 predicted 2392
6 SASI_Hs01_00089454 predicted 520
7 SASI_Hs02_00366443 predicted 708
8 SASI_Hs01_00089455 predicted 1787
9 SASI_Hs01_00089457 predicted 1985
10 SASI_Hs02_00366444 predicted 1506
11 SASI_Hs01_00089451 predicted 1730
12 SASI_Hs01_00089456 predicted 1868
13 SASI_Hs01_00089458 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091250 predicted 510
2 SASI_Rn01_00091251 predicted 1488
3 SASI_Rn01_00091252 predicted 1063
4 SASI_Rn01_00091253 predicted 1638
5 SASI_Rn01_00091254 predicted 333
6 SASI_Rn01_00091255 predicted 1048
7 SASI_Rn01_00091256 predicted 2581
8 SASI_Rn02_00201310 predicted 2400
9 SASI_Rn01_00091258 predicted 2521
10 SASI_Rn01_00091259 predicted 1563
11 SASI_Rn01_00091257 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147050 predicted 608
2 SASI_Mm01_00147051 predicted 647
3 SASI_Mm01_00147052 predicted 640
4 SASI_Mm01_00147053 predicted 562
5 SASI_Mm01_00147054 predicted 581
6 SASI_Mm01_00147055 predicted 671
7 SASI_Mm01_00147056 predicted 630
8 SASI_Mm01_00147057 predicted 501
9 SASI_Mm01_00147058 predicted 535
10 SASI_Mm01_00147059 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152598
MARCH10 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-2438s1c1
Sequence:CCGGCCTGGGTGACTTTAACATGATCTCGAGATCATGTTAAAGTCACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152598.1-2806s1c1
Sequence:CCGGCAAAGCGTTCACAGTTAGATTCTCGAGAATCTAACTGTGAACGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-540s1c1
Sequence:CCGGGCATTTAAGTGTGACTCCAAACTCGAGTTTGGAGTCACACTTAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-517s1c1
Sequence:CCGGCAAGGTCATCTATCAAGATATCTCGAGATATCTTGATAGATGACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-1570s1c1
Sequence:CCGGGCACCCATGATTCTGAAGGATCTCGAGATCCTTCAGAATCATGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1912s21c1
Sequence:CCGGGAAGCAGAAGATACTACTTTACTCGAGTAAAGTAGTATCTTCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1975s21c1
Sequence:CCGGCTAAATCCACAGGGCAATTTGCTCGAGCAAATTGCCCTGTGGATTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1882s21c1
Sequence:CCGGGTAAACAGTGCACACGAATTTCTCGAGAAATTCGTGTGCACTGTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-705s21c1
Sequence:CCGGGCCAAACCTGAGGAGATTTACCTCGAGGTAAATCTCCTCAGGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1072s21c1
Sequence:CCGGGGGCCAAGAAAGGCATCATTTCTCGAGAAATGATGCCTTTCTTGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152598
MARCH10 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-2438s1c1
Sequence:CCGGCCTGGGTGACTTTAACATGATCTCGAGATCATGTTAAAGTCACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152598.1-2806s1c1
Sequence:CCGGCAAAGCGTTCACAGTTAGATTCTCGAGAATCTAACTGTGAACGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-540s1c1
Sequence:CCGGGCATTTAAGTGTGACTCCAAACTCGAGTTTGGAGTCACACTTAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-517s1c1
Sequence:CCGGCAAGGTCATCTATCAAGATATCTCGAGATATCTTGATAGATGACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-1570s1c1
Sequence:CCGGGCACCCATGATTCTGAAGGATCTCGAGATCCTTCAGAATCATGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1912s21c1
Sequence:CCGGGAAGCAGAAGATACTACTTTACTCGAGTAAAGTAGTATCTTCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1975s21c1
Sequence:CCGGCTAAATCCACAGGGCAATTTGCTCGAGCAAATTGCCCTGTGGATTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1882s21c1
Sequence:CCGGGTAAACAGTGCACACGAATTTCTCGAGAAATTCGTGTGCACTGTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-705s21c1
Sequence:CCGGGCCAAACCTGAGGAGATTTACCTCGAGGTAAATCTCCTCAGGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1072s21c1
Sequence:CCGGGGGCCAAGAAAGGCATCATTTCTCGAGAAATGATGCCTTTCTTGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152598
MARCH10 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-2438s1c1
Sequence:CCGGCCTGGGTGACTTTAACATGATCTCGAGATCATGTTAAAGTCACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152598.1-2806s1c1
Sequence:CCGGCAAAGCGTTCACAGTTAGATTCTCGAGAATCTAACTGTGAACGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-540s1c1
Sequence:CCGGGCATTTAAGTGTGACTCCAAACTCGAGTTTGGAGTCACACTTAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-517s1c1
Sequence:CCGGCAAGGTCATCTATCAAGATATCTCGAGATATCTTGATAGATGACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152598.1-1570s1c1
Sequence:CCGGGCACCCATGATTCTGAAGGATCTCGAGATCCTTCAGAATCATGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1912s21c1
Sequence:CCGGGAAGCAGAAGATACTACTTTACTCGAGTAAAGTAGTATCTTCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1975s21c1
Sequence:CCGGCTAAATCCACAGGGCAATTTGCTCGAGCAAATTGCCCTGTGGATTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1882s21c1
Sequence:CCGGGTAAACAGTGCACACGAATTTCTCGAGAAATTCGTGTGCACTGTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-705s21c1
Sequence:CCGGGCCAAACCTGAGGAGATTTACCTCGAGGTAAATCTCCTCAGGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152598.2-1072s21c1
Sequence:CCGGGGGCCAAGAAAGGCATCATTTCTCGAGAAATGATGCCTTTCTTGGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039242
MARCH10 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039242.2-1083s21c1
Sequence:CCGGCTAGCGAGGCACACAGCACAACTCGAGTTGTGCTGTGTGCCTCGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-440s21c1
Sequence:CCGGTCAGAATATCAGGCTTGTTTGCTCGAGCAAACAAGCCTGATATTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-404s21c1
Sequence:CCGGGTTCAGTATCTACGGGATATGCTCGAGCATATCCCGTAGATACTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-589s21c1
Sequence:CCGGTCGCAGTGAAGCAAGATTATCCTCGAGGATAATCTTGCTTCACTGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-814s21c1
Sequence:CCGGCCAGCAGCCCAATACCAATTACTCGAGTAATTGGTATTGGGCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039242
MARCH10 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039242.2-1083s21c1
Sequence:CCGGCTAGCGAGGCACACAGCACAACTCGAGTTGTGCTGTGTGCCTCGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-440s21c1
Sequence:CCGGTCAGAATATCAGGCTTGTTTGCTCGAGCAAACAAGCCTGATATTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-404s21c1
Sequence:CCGGGTTCAGTATCTACGGGATATGCTCGAGCATATCCCGTAGATACTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-589s21c1
Sequence:CCGGTCGCAGTGAAGCAAGATTATCCTCGAGGATAATCTTGCTTCACTGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-814s21c1
Sequence:CCGGCCAGCAGCCCAATACCAATTACTCGAGTAATTGGTATTGGGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039242
MARCH10 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039242.2-1083s21c1
Sequence:CCGGCTAGCGAGGCACACAGCACAACTCGAGTTGTGCTGTGTGCCTCGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-440s21c1
Sequence:CCGGTCAGAATATCAGGCTTGTTTGCTCGAGCAAACAAGCCTGATATTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-404s21c1
Sequence:CCGGGTTCAGTATCTACGGGATATGCTCGAGCATATCCCGTAGATACTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-589s21c1
Sequence:CCGGTCGCAGTGAAGCAAGATTATCCTCGAGGATAATCTTGCTTCACTGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039242.2-814s21c1
Sequence:CCGGCCAGCAGCCCAATACCAATTACTCGAGTAATTGGTATTGGGCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)