EMAIL THIS PAGE TO A FRIEND

MARCH11

membrane-associated ring finger (C3HC4) 11

60 Gene Product Result for
Synonyms: MARCH-XI
UniProtKB ID: A6NNE9, A7E2S6
Gene ID:
Human(441061) Summary: MARCH11 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). These enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their intracellular transport. March11 appears to have a role in ubiquitin-mediated protein sorting in the trans-Golgi network (TGN)-multivesicular body (MVB) transport pathway (Morokuma et al., 2007 [PubMed 17604280]
Mouse(211147) membrane-associated ring finger (C3HC4) 11
Rat(499558) membrane-associated ring finger (C3HC4) 11
Zebrafish(798174) membrane-associated ring finger (C3HC4) 11
cow(781742) membrane-associated ring finger (C3HC4) 11
domestic cat(101089674) membrane-associated ring finger (C3HC4) 11
dog(479384) membrane-associated ring finger (C3HC4) 11
chicken(420914) membrane-associated ring finger (C3HC4) 11
sheep(101102675) membrane-associated ring finger (C3HC4) 11
naked mole-rat(101705369) membrane-associated ring finger (C3HC4) 11
domestic guinea pig(100720329) membrane-associated ring finger (C3HC4) 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102562 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047071 MISSION® esiRNA esiRNA human MARCH11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102562 Rosetta Predictions human pricing
XM_496738 Rosetta Predictions human pricing
NM_001101828 Rosetta Predictions rat pricing
NM_177597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323233 predicted 1092
2 SASI_Hs02_00323234 predicted 1119
3 SASI_Hs02_00323235 predicted 1051
4 SASI_Hs02_00323236 predicted 923
5 SASI_Hs02_00323237 predicted 1180
6 SASI_Hs02_00323238 predicted 1114
7 SASI_Hs02_00323239 predicted 957
8 SASI_Hs02_00323240 predicted 1295
9 SASI_Hs02_00323241 predicted 1054
10 SASI_Hs02_00323242 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290513 predicted 1727
2 SASI_Hs01_00290514 predicted 251
3 SASI_Hs01_00290515 predicted 1594
4 SASI_Hs01_00290516 predicted 1559
5 SASI_Hs01_00290517 predicted 227
6 SASI_Hs01_00290518 predicted 1749
7 SASI_Hs01_00290519 predicted 1404
8 SASI_Hs01_00290520 predicted 1657
9 SASI_Hs01_00290521 predicted 1907
10 SASI_Hs01_00290522 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211394 predicted 916
2 SASI_Rn02_00211395 predicted 1296
3 SASI_Rn02_00211396 predicted 1305
4 SASI_Rn02_00211397 predicted 1101
5 SASI_Rn02_00211398 predicted 1264
6 SASI_Rn02_00211399 predicted 1126
7 SASI_Rn02_00211400 predicted 826
8 SASI_Rn02_00211401 predicted 685
9 SASI_Rn02_00211402 predicted 930
10 SASI_Rn02_00211403 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347784 predicted 907
2 SASI_Mm02_00347785 predicted 1289
3 SASI_Mm02_00347786 predicted 1295
4 SASI_Mm02_00347787 predicted 598
5 SASI_Mm01_00194051 predicted 726
6 SASI_Mm02_00347788 predicted 1256
7 SASI_Mm02_00347789 predicted 1092
8 SASI_Mm02_00347790 predicted 1199
9 SASI_Mm02_00347791 predicted 1077
10 SASI_Mm02_00347792 predicted 1119
11 SASI_Mm01_00194048 predicted 851
12 SASI_Mm01_00194049 predicted 1454
13 SASI_Mm01_00194050 predicted 889
14 SASI_Mm01_00194052 predicted 762
15 SASI_Mm01_00194053 predicted 969
16 SASI_Mm01_00194054 predicted 241
17 SASI_Mm01_00194055 predicted 707
18 SASI_Mm01_00194056 predicted 709
19 SASI_Mm01_00194057 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102562
MARCH11 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-776s21c1
Sequence:CCGGGTGATGGGTCAGTTCGGTATACTCGAGTATACCGAACTGACCCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-866s21c1
Sequence:CCGGGATACCATGTTATAGCCATTACTCGAGTAATGGCTATAACATGGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-1191s21c1
Sequence:CCGGAGCCACAGACATCGAAGAAAGCTCGAGCTTTCTTCGATGTCTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-959s21c1
Sequence:CCGGTCCTAGGATCCCTGTTCTTAACTCGAGTTAAGAACAGGGATCCTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-1160s21c1
Sequence:CCGGATTTGCACTGGGATGTGTTAACTCGAGTTAACACATCCCAGTGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102562
MARCH11 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-776s21c1
Sequence:CCGGGTGATGGGTCAGTTCGGTATACTCGAGTATACCGAACTGACCCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-866s21c1
Sequence:CCGGGATACCATGTTATAGCCATTACTCGAGTAATGGCTATAACATGGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-1191s21c1
Sequence:CCGGAGCCACAGACATCGAAGAAAGCTCGAGCTTTCTTCGATGTCTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-959s21c1
Sequence:CCGGTCCTAGGATCCCTGTTCTTAACTCGAGTTAAGAACAGGGATCCTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-1160s21c1
Sequence:CCGGATTTGCACTGGGATGTGTTAACTCGAGTTAACACATCCCAGTGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102562
MARCH11 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-776s21c1
Sequence:CCGGGTGATGGGTCAGTTCGGTATACTCGAGTATACCGAACTGACCCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-866s21c1
Sequence:CCGGGATACCATGTTATAGCCATTACTCGAGTAATGGCTATAACATGGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-1191s21c1
Sequence:CCGGAGCCACAGACATCGAAGAAAGCTCGAGCTTTCTTCGATGTCTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-959s21c1
Sequence:CCGGTCCTAGGATCCCTGTTCTTAACTCGAGTTAAGAACAGGGATCCTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102562.1-1160s21c1
Sequence:CCGGATTTGCACTGGGATGTGTTAACTCGAGTTAACACATCCCAGTGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177597
MARCH11 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 11
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177597.2-1843s1c1
Sequence:CCGGCCACTAGGTTTACCCATGATACTCGAGTATCATGGGTAAACCTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177597.2-1050s1c1
Sequence:CCGGGCTTAGAGAAAGCCATGACATCTCGAGATGTCATGGCTTTCTCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177597.2-704s1c1
Sequence:CCGGCCATCAGCCCATTTGCAAGATCTCGAGATCTTGCAAATGGGCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177597.2-898s1c1
Sequence:CCGGGCCAGGTAGACACAATGTTCACTCGAGTGAACATTGTGTCTACCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177597
MARCH11 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 11
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177597.2-1843s1c1
Sequence:CCGGCCACTAGGTTTACCCATGATACTCGAGTATCATGGGTAAACCTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177597.2-1050s1c1
Sequence:CCGGGCTTAGAGAAAGCCATGACATCTCGAGATGTCATGGCTTTCTCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177597.2-704s1c1
Sequence:CCGGCCATCAGCCCATTTGCAAGATCTCGAGATCTTGCAAATGGGCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177597.2-898s1c1
Sequence:CCGGGCCAGGTAGACACAATGTTCACTCGAGTGAACATTGTGTCTACCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177597
MARCH11 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 11
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177597.2-1843s1c1
Sequence:CCGGCCACTAGGTTTACCCATGATACTCGAGTATCATGGGTAAACCTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177597.2-1050s1c1
Sequence:CCGGGCTTAGAGAAAGCCATGACATCTCGAGATGTCATGGCTTTCTCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177597.2-704s1c1
Sequence:CCGGCCATCAGCCCATTTGCAAGATCTCGAGATCTTGCAAATGGGCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177597.2-898s1c1
Sequence:CCGGGCCAGGTAGACACAATGTTCACTCGAGTGAACATTGTGTCTACCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)