EMAIL THIS PAGE TO A FRIEND

MARCH1

membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase

65 Gene Product Result for
Synonyms: MARCH-I RNF171
UniProtKB ID: Q8TCQ1, D3DP29, Q9NWR0
Gene ID:
Human(55016) Summary: MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]
Mouse(72925) membrane-associated ring finger (C3HC4) 1
Rat(361135) membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
chicken(422420) membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
cow(617247) membrane-associated ring finger (C3HC4) 1
dog(612618) membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
domestic cat(101098865) membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
sheep(101106078) membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
naked mole-rat(101724772) membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
domestic guinea pig(100722498) membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175188 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175188 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175188 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017923 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017923 Rosetta Predictions human pricing
XM_001071042 Rosetta Predictions rat pricing
XM_341421 Rosetta Predictions rat pricing
NM_175188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052298 predicted 818
2 SASI_Hs02_00350920 predicted 755
3 SASI_Hs01_00052299 predicted 839
4 SASI_Hs01_00052300 predicted 818
5 SASI_Hs01_00052301 predicted 989
6 SASI_Hs01_00052302 predicted 443
7 SASI_Hs01_00052303 predicted 622
8 SASI_Hs01_00052304 predicted 932
9 SASI_Hs01_00052305 predicted 301
10 SASI_Hs01_00052306 predicted 613
11 SASI_Hs01_00052307 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333648 predicted 610
2 SASI_Rn02_00333649 predicted 351
3 SASI_Rn02_00333650 predicted 422
4 SASI_Rn02_00333651 predicted 618
5 SASI_Rn02_00333652 predicted 489
6 SASI_Rn02_00333653 predicted 358
7 SASI_Rn02_00333654 predicted 220
8 SASI_Rn02_00333655 predicted 501
9 SASI_Rn02_00333656 predicted 238
10 SASI_Rn02_00333657 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392892 predicted 616
2 SASI_Rn02_00392893 predicted 351
3 SASI_Rn02_00392894 predicted 415
4 SASI_Rn02_00392895 predicted 618
5 SASI_Rn02_00392896 predicted 489
6 SASI_Rn02_00392897 predicted 360
7 SASI_Rn02_00392898 predicted 220
8 SASI_Rn02_00392899 predicted 500
9 SASI_Rn02_00392900 predicted 238
10 SASI_Rn02_00392901 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107566 predicted 611
2 SASI_Mm01_00107567 predicted 1157
3 SASI_Mm01_00107568 predicted 842
4 SASI_Mm02_00345849 predicted 1107
5 SASI_Mm01_00107569 predicted 1050
6 SASI_Mm01_00107570 predicted 785
7 SASI_Mm01_00107571 predicted 1167
8 SASI_Mm01_00107572 predicted 665
9 SASI_Mm01_00107573 predicted 1266
10 SASI_Mm01_00107574 predicted 549
11 SASI_Mm01_00107575 predicted 926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175188
MARCH1 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175188.4-1710s21c1
Sequence:CCGGGCCTGAAAGTGTGTGCGTTATCTCGAGATAACGCACACACTTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175188.4-1514s21c1
Sequence:CCGGCATAAGGAATGGTTGGTACACCTCGAGGTGTACCAACCATTCCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175188.4-926s21c1
Sequence:CCGGGGTCCTTGTATGTGTTGATAGCTCGAGCTATCAACACATACAAGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175188.3-2869s1c1
Sequence:CCGGCGAAAGAAAGATGACCACATTCTCGAGAATGTGGTCATCTTTCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175188.3-2319s1c1
Sequence:CCGGCCCTTGCATTAGAAACTACATCTCGAGATGTAGTTTCTAATGCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175188.3-550s1c1
Sequence:CCGGGCAAGTCGATCAAGTAACATACTCGAGTATGTTACTTGATCGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175188.3-1159s1c1
Sequence:CCGGGAGAAGAACTTCCCGTGTAATCTCGAGATTACACGGGAAGTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175188
MARCH1 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175188.4-1710s21c1
Sequence:CCGGGCCTGAAAGTGTGTGCGTTATCTCGAGATAACGCACACACTTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175188.4-1514s21c1
Sequence:CCGGCATAAGGAATGGTTGGTACACCTCGAGGTGTACCAACCATTCCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175188.4-926s21c1
Sequence:CCGGGGTCCTTGTATGTGTTGATAGCTCGAGCTATCAACACATACAAGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175188.3-2869s1c1
Sequence:CCGGCGAAAGAAAGATGACCACATTCTCGAGAATGTGGTCATCTTTCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175188.3-2319s1c1
Sequence:CCGGCCCTTGCATTAGAAACTACATCTCGAGATGTAGTTTCTAATGCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175188.3-550s1c1
Sequence:CCGGGCAAGTCGATCAAGTAACATACTCGAGTATGTTACTTGATCGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175188.3-1159s1c1
Sequence:CCGGGAGAAGAACTTCCCGTGTAATCTCGAGATTACACGGGAAGTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175188
MARCH1 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175188.4-1710s21c1
Sequence:CCGGGCCTGAAAGTGTGTGCGTTATCTCGAGATAACGCACACACTTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175188.4-1514s21c1
Sequence:CCGGCATAAGGAATGGTTGGTACACCTCGAGGTGTACCAACCATTCCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175188.4-926s21c1
Sequence:CCGGGGTCCTTGTATGTGTTGATAGCTCGAGCTATCAACACATACAAGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175188.3-2869s1c1
Sequence:CCGGCGAAAGAAAGATGACCACATTCTCGAGAATGTGGTCATCTTTCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175188.3-2319s1c1
Sequence:CCGGCCCTTGCATTAGAAACTACATCTCGAGATGTAGTTTCTAATGCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175188.3-550s1c1
Sequence:CCGGGCAAGTCGATCAAGTAACATACTCGAGTATGTTACTTGATCGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175188.3-1159s1c1
Sequence:CCGGGAGAAGAACTTCCCGTGTAATCTCGAGATTACACGGGAAGTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017923
MARCH1 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017923.3-1134s21c1
Sequence:CCGGGCGTAAAGTAAAGTATGATATCTCGAGATATCATACTTTACTTTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017923.3-1298s21c1
Sequence:CCGGACTTGAATTGCGATGTGTATTCTCGAGAATACACATCGCAATTCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017923.3-461s21c1
Sequence:CCGGTAATGGAGACCAAGCTCAAACCTCGAGGTTTGAGCTTGGTCTCCATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017923.3-1225s21c1
Sequence:CCGGGGCAGTAATCAAAGATTAAATCTCGAGATTTAATCTTTGATTACTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-428s1c1
Sequence:CCGGGCTCTGTCACATTCCACGTAACTCGAGTTACGTGGAATGTGACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-59s1c1
Sequence:CCGGGCAAGATATCAACCATGTATTCTCGAGAATACATGGTTGATATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-80s1c1
Sequence:CCGGACCTTAACCAAGATGCCAAATCTCGAGATTTGGCATCTTGGTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-607s1c1
Sequence:CCGGGTACAGTGTAAAGTCTATGTTCTCGAGAACATAGACTTTACACTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-703s1c1
Sequence:CCGGGAGAAGAACTTCTCATGTAATCTCGAGATTACATGAGAAGTTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017923
MARCH1 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017923.3-1134s21c1
Sequence:CCGGGCGTAAAGTAAAGTATGATATCTCGAGATATCATACTTTACTTTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017923.3-1298s21c1
Sequence:CCGGACTTGAATTGCGATGTGTATTCTCGAGAATACACATCGCAATTCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017923.3-461s21c1
Sequence:CCGGTAATGGAGACCAAGCTCAAACCTCGAGGTTTGAGCTTGGTCTCCATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017923.3-1225s21c1
Sequence:CCGGGGCAGTAATCAAAGATTAAATCTCGAGATTTAATCTTTGATTACTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-428s1c1
Sequence:CCGGGCTCTGTCACATTCCACGTAACTCGAGTTACGTGGAATGTGACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-59s1c1
Sequence:CCGGGCAAGATATCAACCATGTATTCTCGAGAATACATGGTTGATATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-80s1c1
Sequence:CCGGACCTTAACCAAGATGCCAAATCTCGAGATTTGGCATCTTGGTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-607s1c1
Sequence:CCGGGTACAGTGTAAAGTCTATGTTCTCGAGAACATAGACTTTACACTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-703s1c1
Sequence:CCGGGAGAAGAACTTCTCATGTAATCTCGAGATTACATGAGAAGTTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017923
MARCH1 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017923.3-1134s21c1
Sequence:CCGGGCGTAAAGTAAAGTATGATATCTCGAGATATCATACTTTACTTTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017923.3-1298s21c1
Sequence:CCGGACTTGAATTGCGATGTGTATTCTCGAGAATACACATCGCAATTCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017923.3-461s21c1
Sequence:CCGGTAATGGAGACCAAGCTCAAACCTCGAGGTTTGAGCTTGGTCTCCATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017923.3-1225s21c1
Sequence:CCGGGGCAGTAATCAAAGATTAAATCTCGAGATTTAATCTTTGATTACTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-428s1c1
Sequence:CCGGGCTCTGTCACATTCCACGTAACTCGAGTTACGTGGAATGTGACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-59s1c1
Sequence:CCGGGCAAGATATCAACCATGTATTCTCGAGAATACATGGTTGATATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-80s1c1
Sequence:CCGGACCTTAACCAAGATGCCAAATCTCGAGATTTGGCATCTTGGTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-607s1c1
Sequence:CCGGGTACAGTGTAAAGTCTATGTTCTCGAGAACATAGACTTTACACTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017923.1-703s1c1
Sequence:CCGGGAGAAGAACTTCTCATGTAATCTCGAGATTACATGAGAAGTTCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)