EMAIL THIS PAGE TO A FRIEND

MARCH3

membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase

101 Gene Product Result for
Synonyms: MARCH-III RNF173
UniProtKB ID: Q86UD3, A8K264
Gene ID:
Human(115123) Summary: This gene encodes a member of the membrane-associated RING-CH (MARCH) family. The encoded protein is an E3 ubiquitin-protein ligase that may be involved in regulation of the endosomal transport pathway. [provided by RefSeq, Mar 2013]
Mouse(320253) membrane-associated ring finger (C3HC4) 3
Rat(364878) membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
chicken(768965) membrane-associated ring finger (C3HC4) 3
cow(520348) membrane-associated ring finger (C3HC4) 3
domestic cat(101087378) membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
dog(481488) membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
sheep(101106841) membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
naked mole-rat(101709531) membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
domestic guinea pig(100731413) membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004921 MISSION® esiRNA esiRNA targeting human MARCH3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178450 Rosetta Predictions human pricing
NM_001007759 Rosetta Predictions rat pricing
NM_177115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241751 predicted 344
2 SASI_Hs01_00241752 predicted 922
3 SASI_Hs02_00369679 predicted 945
4 SASI_Hs01_00241753 predicted 374
5 SASI_Hs01_00241754 predicted 1001
6 SASI_Hs01_00241756 predicted 1013
7 SASI_Hs01_00241757 predicted 1117
8 SASI_Hs02_00369680 predicted 833
9 SASI_Hs01_00241758 predicted 646
10 SASI_Hs01_00241760 predicted 996
11 SASI_Hs01_00241755 predicted 1045
12 SASI_Hs01_00241759 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091987 predicted 966
2 SASI_Rn01_00091988 predicted 1010
3 SASI_Rn01_00091989 predicted 474
4 SASI_Rn01_00091990 predicted 923
5 SASI_Rn01_00091991 predicted 897
6 SASI_Rn01_00091992 predicted 672
7 SASI_Rn01_00091993 predicted 976
8 SASI_Rn01_00091994 predicted 349
9 SASI_Rn01_00091996 predicted 815
10 SASI_Rn02_00198956 predicted 1102
11 SASI_Rn01_00091995 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114581 predicted 898
2 SASI_Mm01_00114582 predicted 535
3 SASI_Mm01_00114583 predicted 734
4 SASI_Mm01_00114584 predicted 979
5 SASI_Mm01_00114585 predicted 382
6 SASI_Mm01_00114587 predicted 408
7 SASI_Mm01_00114589 predicted 888
8 SASI_Mm01_00114590 predicted 674
9 SASI_Mm02_00347107 predicted 496
10 SASI_Mm02_00347108 predicted 647
11 SASI_Mm01_00114586 predicted 543
12 SASI_Mm01_00114588 predicted 865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178450
MARCH3 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178450.3-1309s21c1
Sequence:CCGGCCTTAAGCCTGTGGGTCTAAGCTCGAGCTTAGACCCACAGGCTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178450.2-1581s1c1
Sequence:CCGGGCAGAACAAGTCATATTTGAACTCGAGTTCAAATATGACTTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-839s1c1
Sequence:CCGGCTCTTCACTATTTACCTCTTTCTCGAGAAAGAGGTAAATAGTGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-920s1c1
Sequence:CCGGCAGAGGGTGATTCTCCTCATTCTCGAGAATGAGGAGAATCACCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-838s1c1
Sequence:CCGGACTCTTCACTATTTACCTCTTCTCGAGAAGAGGTAAATAGTGAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-377s1c1
Sequence:CCGGCCGCAGTATGTCATGCAAGTTCTCGAGAACTTGCATGACATACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178450.3-1196s21c1
Sequence:CCGGCTCAAAGGAGACAGTTGTTTGCTCGAGCAAACAACTGTCTCCTTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178450.3-1137s21c1
Sequence:CCGGTCTGTCAATGTACCTTCTAACCTCGAGGTTAGAAGGTACATTGACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178450.3-1517s21c1
Sequence:CCGGTGCTACGGATGCAATTCAATTCTCGAGAATTGAATTGCATCCGTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178450
MARCH3 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178450.3-1309s21c1
Sequence:CCGGCCTTAAGCCTGTGGGTCTAAGCTCGAGCTTAGACCCACAGGCTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178450.2-1581s1c1
Sequence:CCGGGCAGAACAAGTCATATTTGAACTCGAGTTCAAATATGACTTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-839s1c1
Sequence:CCGGCTCTTCACTATTTACCTCTTTCTCGAGAAAGAGGTAAATAGTGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-920s1c1
Sequence:CCGGCAGAGGGTGATTCTCCTCATTCTCGAGAATGAGGAGAATCACCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-838s1c1
Sequence:CCGGACTCTTCACTATTTACCTCTTCTCGAGAAGAGGTAAATAGTGAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-377s1c1
Sequence:CCGGCCGCAGTATGTCATGCAAGTTCTCGAGAACTTGCATGACATACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178450.3-1196s21c1
Sequence:CCGGCTCAAAGGAGACAGTTGTTTGCTCGAGCAAACAACTGTCTCCTTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178450.3-1137s21c1
Sequence:CCGGTCTGTCAATGTACCTTCTAACCTCGAGGTTAGAAGGTACATTGACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178450.3-1517s21c1
Sequence:CCGGTGCTACGGATGCAATTCAATTCTCGAGAATTGAATTGCATCCGTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178450
MARCH3 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178450.3-1309s21c1
Sequence:CCGGCCTTAAGCCTGTGGGTCTAAGCTCGAGCTTAGACCCACAGGCTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178450.2-1581s1c1
Sequence:CCGGGCAGAACAAGTCATATTTGAACTCGAGTTCAAATATGACTTGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-839s1c1
Sequence:CCGGCTCTTCACTATTTACCTCTTTCTCGAGAAAGAGGTAAATAGTGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-920s1c1
Sequence:CCGGCAGAGGGTGATTCTCCTCATTCTCGAGAATGAGGAGAATCACCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-838s1c1
Sequence:CCGGACTCTTCACTATTTACCTCTTCTCGAGAAGAGGTAAATAGTGAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178450.2-377s1c1
Sequence:CCGGCCGCAGTATGTCATGCAAGTTCTCGAGAACTTGCATGACATACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178450.3-1196s21c1
Sequence:CCGGCTCAAAGGAGACAGTTGTTTGCTCGAGCAAACAACTGTCTCCTTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178450.3-1137s21c1
Sequence:CCGGTCTGTCAATGTACCTTCTAACCTCGAGGTTAGAAGGTACATTGACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178450.3-1517s21c1
Sequence:CCGGTGCTACGGATGCAATTCAATTCTCGAGAATTGAATTGCATCCGTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177115
MARCH3 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177115.2-613s1c1
Sequence:CCGGGTCATCCTCAAATACCAGCTACTCGAGTAGCTGGTATTTGAGGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177115.2-1135s21c1
Sequence:CCGGCCCTGTGTCTTCTTCAATTTACTCGAGTAAATTGAAGAAGACACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-605s21c1
Sequence:CCGGCACTGGCTGTCATCCTCAAATCTCGAGATTTGAGGATGACAGCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-724s21c1
Sequence:CCGGGCGGACTCTGTTTGGAGATATCTCGAGATATCTCCAAACAGAGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-891s21c1
Sequence:CCGGTCTGGACACTAAGGCGTTATGCTCGAGCATAACGCCTTAGTGTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-865s21c1
Sequence:CCGGTGTGGCACTCTTCACCATTTACTCGAGTAAATGGTGAAGAGTGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177115
MARCH3 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177115.2-613s1c1
Sequence:CCGGGTCATCCTCAAATACCAGCTACTCGAGTAGCTGGTATTTGAGGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177115.2-1135s21c1
Sequence:CCGGCCCTGTGTCTTCTTCAATTTACTCGAGTAAATTGAAGAAGACACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-605s21c1
Sequence:CCGGCACTGGCTGTCATCCTCAAATCTCGAGATTTGAGGATGACAGCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-724s21c1
Sequence:CCGGGCGGACTCTGTTTGGAGATATCTCGAGATATCTCCAAACAGAGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-891s21c1
Sequence:CCGGTCTGGACACTAAGGCGTTATGCTCGAGCATAACGCCTTAGTGTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-865s21c1
Sequence:CCGGTGTGGCACTCTTCACCATTTACTCGAGTAAATGGTGAAGAGTGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177115
MARCH3 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 3, E3 ubiquitin protein ligase
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177115.2-613s1c1
Sequence:CCGGGTCATCCTCAAATACCAGCTACTCGAGTAGCTGGTATTTGAGGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177115.2-1135s21c1
Sequence:CCGGCCCTGTGTCTTCTTCAATTTACTCGAGTAAATTGAAGAAGACACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-605s21c1
Sequence:CCGGCACTGGCTGTCATCCTCAAATCTCGAGATTTGAGGATGACAGCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-724s21c1
Sequence:CCGGGCGGACTCTGTTTGGAGATATCTCGAGATATCTCCAAACAGAGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-891s21c1
Sequence:CCGGTCTGGACACTAAGGCGTTATGCTCGAGCATAACGCCTTAGTGTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177115.2-865s21c1
Sequence:CCGGTGTGGCACTCTTCACCATTTACTCGAGTAAATGGTGAAGAGTGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)