EMAIL THIS PAGE TO A FRIEND

MARCH4

membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase

102 Gene Product Result for
Synonyms: MARCH-IV RNF174
UniProtKB ID: Q9P2E8, Q4KMN7, Q86WR8
Gene ID:
Human(57574) Summary: MARCH4 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH4 reduces surface accumulation of several membrane glycoproteins by directing them to the endosomal compartment (Bartee et al., 2004 [PubMed 14722266]
Mouse(381270) membrane-associated ring finger (C3HC4) 4
Rat(367295) membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
domestic guinea pig(100725253) membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
naked mole-rat(101718651) membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
sheep(101107500) membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
Zebrafish(562065) membrane-associated ring finger (C3HC4) 4
domestic cat(101082766) membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
cow(527624) membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
Horse(100050538) membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
dog(488515) membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001045533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020814 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007841 MISSION® esiRNA esiRNA targeting human MARCH4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020814 Rosetta Predictions human pricing
XM_001055311 Rosetta Predictions rat pricing
XM_001074008 Rosetta Predictions rat pricing
NM_001045533 Rosetta Predictions mouse pricing
XM_619638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354009 predicted 2445
2 SASI_Hs01_00235206 predicted 2880
3 SASI_Hs01_00235207 predicted 2338
4 SASI_Hs02_00354010 predicted 1814
5 SASI_Hs01_00235208 predicted 3174
6 SASI_Hs01_00235209 predicted 2678
7 SASI_Hs01_00235210 predicted 2288
8 SASI_Hs01_00235212 predicted 3397
9 SASI_Hs01_00235213 predicted 2697
10 SASI_Hs02_00354011 predicted 2240
11 SASI_Hs01_00235211 predicted 2519
12 SASI_Hs01_00235214 predicted 2898
13 SASI_Hs01_00235215 predicted 2172
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279147 predicted 403
2 SASI_Rn02_00279148 predicted 601
3 SASI_Rn02_00279149 predicted 998
4 SASI_Rn02_00279150 predicted 348
5 SASI_Rn02_00279151 predicted 634
6 SASI_Rn02_00279152 predicted 429
7 SASI_Rn02_00279153 predicted 559
8 SASI_Rn02_00279154 predicted 682
9 SASI_Rn02_00279155 predicted 401
10 SASI_Rn02_00279156 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344757 predicted 407
2 SASI_Rn02_00344758 predicted 601
3 SASI_Rn02_00344759 predicted 992
4 SASI_Rn02_00344760 predicted 349
5 SASI_Rn02_00344761 predicted 632
6 SASI_Rn02_00344762 predicted 426
7 SASI_Rn02_00344763 predicted 559
8 SASI_Rn02_00344764 predicted 685
9 SASI_Rn02_00344765 predicted 406
10 SASI_Rn02_00344766 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291674 predicted 2094
2 SASI_Mm02_00291675 predicted 2221
3 SASI_Mm02_00291676 predicted 1946
4 SASI_Mm02_00291677 predicted 1823
5 SASI_Mm02_00291678 predicted 1991
6 SASI_Mm02_00291679 predicted 2674
7 SASI_Mm02_00291680 predicted 2079
8 SASI_Mm02_00291681 predicted 2549
9 SASI_Mm02_00291682 predicted 1964
10 SASI_Mm02_00291683 predicted 2442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235844 predicted 2564
2 SASI_Mm01_00235845 predicted 2594
3 SASI_Mm01_00235846 predicted 2794
4 SASI_Mm01_00235847 predicted 2721
5 SASI_Mm01_00235848 predicted 3024
6 SASI_Mm01_00235849 predicted 2848
7 SASI_Mm01_00235850 predicted 2819
8 SASI_Mm01_00235851 predicted 2555
9 SASI_Mm01_00235852 predicted 2359
10 SASI_Mm01_00235853 predicted 2982
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045533
MARCH4 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3459s21c1
Sequence:CCGGCTGTCAGGCCAGGGATGATTTCTCGAGAAATCATCCCTGGCCTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3316s21c1
Sequence:CCGGTTGTTTACCTTACGGTGATTTCTCGAGAAATCACCGTAAGGTAAACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-2837s21c1
Sequence:CCGGACAACAATGGGTGGGACAAATCTCGAGATTTGTCCCACCCATTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3799s21c1
Sequence:CCGGAGGCGTGAACACCTAACTAAGCTCGAGCTTAGTTAGGTGTTCACGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3097s21c1
Sequence:CCGGTTGTGAGCTGGTGGTCCTAATCTCGAGATTAGGACCACCAGCTCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045533
MARCH4 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3459s21c1
Sequence:CCGGCTGTCAGGCCAGGGATGATTTCTCGAGAAATCATCCCTGGCCTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3316s21c1
Sequence:CCGGTTGTTTACCTTACGGTGATTTCTCGAGAAATCACCGTAAGGTAAACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-2837s21c1
Sequence:CCGGACAACAATGGGTGGGACAAATCTCGAGATTTGTCCCACCCATTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3799s21c1
Sequence:CCGGAGGCGTGAACACCTAACTAAGCTCGAGCTTAGTTAGGTGTTCACGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3097s21c1
Sequence:CCGGTTGTGAGCTGGTGGTCCTAATCTCGAGATTAGGACCACCAGCTCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045533
MARCH4 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3459s21c1
Sequence:CCGGCTGTCAGGCCAGGGATGATTTCTCGAGAAATCATCCCTGGCCTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3316s21c1
Sequence:CCGGTTGTTTACCTTACGGTGATTTCTCGAGAAATCACCGTAAGGTAAACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-2837s21c1
Sequence:CCGGACAACAATGGGTGGGACAAATCTCGAGATTTGTCCCACCCATTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3799s21c1
Sequence:CCGGAGGCGTGAACACCTAACTAAGCTCGAGCTTAGTTAGGTGTTCACGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045533.1-3097s21c1
Sequence:CCGGTTGTGAGCTGGTGGTCCTAATCTCGAGATTAGGACCACCAGCTCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020814
MARCH4 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2168s1c1
Sequence:CCGGCCTCCTCAGATGACTTCTGTACTCGAGTACAGAAGTCATCTGAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020814.1-3158s1c1
Sequence:CCGGGCAGGAGCAGTTCTGCTATTTCTCGAGAAATAGCAGAACTGCTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2406s1c1
Sequence:CCGGCGTCATCGCCATAAGCACAAACTCGAGTTTGTGCTTATGGCGATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2516s1c1
Sequence:CCGGCCAGTATTTCTTGGCTCATCTCTCGAGAGATGAGCCAAGAAATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2571s1c1
Sequence:CCGGCCAAGACCTTCTCTTCCAGATCTCGAGATCTGGAAGAGAAGGTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020814
MARCH4 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2168s1c1
Sequence:CCGGCCTCCTCAGATGACTTCTGTACTCGAGTACAGAAGTCATCTGAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020814.1-3158s1c1
Sequence:CCGGGCAGGAGCAGTTCTGCTATTTCTCGAGAAATAGCAGAACTGCTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2406s1c1
Sequence:CCGGCGTCATCGCCATAAGCACAAACTCGAGTTTGTGCTTATGGCGATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2516s1c1
Sequence:CCGGCCAGTATTTCTTGGCTCATCTCTCGAGAGATGAGCCAAGAAATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2571s1c1
Sequence:CCGGCCAAGACCTTCTCTTCCAGATCTCGAGATCTGGAAGAGAAGGTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020814
MARCH4 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2168s1c1
Sequence:CCGGCCTCCTCAGATGACTTCTGTACTCGAGTACAGAAGTCATCTGAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020814.1-3158s1c1
Sequence:CCGGGCAGGAGCAGTTCTGCTATTTCTCGAGAAATAGCAGAACTGCTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2406s1c1
Sequence:CCGGCGTCATCGCCATAAGCACAAACTCGAGTTTGTGCTTATGGCGATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2516s1c1
Sequence:CCGGCCAGTATTTCTTGGCTCATCTCTCGAGAGATGAGCCAAGAAATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020814.1-2571s1c1
Sequence:CCGGCCAAGACCTTCTCTTCCAGATCTCGAGATCTGGAAGAGAAGGTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)