EMAIL THIS PAGE TO A FRIEND

MARCH5

membrane-associated ring finger (C3HC4) 5

208 Gene Product Result for
Synonyms: MARCH-V MITOL RNF153
UniProtKB ID: Q9NX47
Gene ID:
Human(54708) Summary: MARCH5 is a ubiquitin ligase of the mitochondrial outer membrane that plays a role in the control of mitochondrial morphology by regulating mitofusin-2 (MFN2; MIM 608507) and DRP1 (DNM1L; MIM 603850) (Nakamura et al., 2006 [PubMed 16936636]
Mouse(69104) membrane-associated ring finger (C3HC4) 5
Rat(294079) membrane-associated ring finger (C3HC4) 5
Zebrafish(561952) membrane-associated ring finger (C3HC4) 5
chicken(423815) membrane-associated ring finger (C3HC4) 5
cow(540937) membrane-associated ring finger (C3HC4) 5
domestic cat(101085407) membrane-associated ring finger (C3HC4) 5
dog(612766) membrane-associated ring finger (C3HC4) 5
sheep(101102440) membrane-associated ring finger (C3HC4) 5
domestic guinea pig(100723777) membrane-associated ring finger (C3HC4) 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017824 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017824 Rosetta Predictions human pricing
NM_001106372 Rosetta Predictions rat pricing
NM_027314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042052 predicted 1187
2 SASI_Hs01_00042054 predicted 823
3 SASI_Hs01_00042056 predicted 1005
4 SASI_Hs02_00350695 predicted 781
5 SASI_Hs01_00042057 predicted 667
6 SASI_Hs01_00042058 predicted 1259
7 SASI_Hs02_00350696 predicted 1249
8 SASI_Hs01_00042059 predicted 897
9 SASI_Hs01_00042060 predicted 1054
10 SASI_Hs02_00350697 predicted 1056
11 SASI_Hs01_00042053 predicted 1094
12 SASI_Hs01_00042055 predicted 1018
13 SASI_Hs01_00042061 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218318 predicted 816
2 SASI_Rn02_00218319 predicted 957
3 SASI_Rn02_00218320 predicted 1043
4 SASI_Rn02_00218321 predicted 874
5 SASI_Rn02_00218322 predicted 343
6 SASI_Rn02_00218323 predicted 618
7 SASI_Rn02_00218324 predicted 775
8 SASI_Rn02_00218325 predicted 592
9 SASI_Rn02_00218326 predicted 1056
10 SASI_Rn02_00218327 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059345 predicted 716
2 SASI_Mm01_00059346 predicted 813
3 SASI_Mm01_00059347 predicted 903
4 SASI_Mm01_00059348 predicted 384
5 SASI_Mm01_00059350 predicted 487
6 SASI_Mm01_00059351 predicted 535
7 SASI_Mm01_00059352 predicted 347
8 SASI_Mm02_00331938 predicted 823
9 SASI_Mm01_00059353 predicted 737
10 SASI_Mm01_00059354 predicted 791
11 SASI_Mm01_00059349 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017824
MARCH5 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-921s21c1
Sequence:CCGGGCCAATCCTTTAGCAGATCATCTCGAGATGATCTGCTAAAGGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-827s21c1
Sequence:CCGGGCTTAGACTGTGGCGCAAATACTCGAGTATTTGCGCCACAGTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-881s1c1
Sequence:CCGGGCCAATCCTTTAGCAGATCATCTCGAGATGATCTGCTAAAGGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-787s1c1
Sequence:CCGGGCTTAGACTGTGGCGCAAATACTCGAGTATTTGCGCCACAGTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-1017s1c1
Sequence:CCGGGAATTGCGTTTGTTGCCATAACTCGAGTTATGGCAACAAACGCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-533s1c1
Sequence:CCGGCCAGTGGTTTACGTCTTGGATCTCGAGATCCAAGACGTAAACCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-325s1c1
Sequence:CCGGCAGAAGTTGCTGGGTTTGTTTCTCGAGAAACAAACCCAGCAACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-573s21c1
Sequence:CCGGCCAGTGGTTTACGTCTTGGATCTCGAGATCCAAGACGTAAACCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-365s21c1
Sequence:CCGGCAGAAGTTGCTGGGTTTGTTTCTCGAGAAACAAACCCAGCAACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-1057s21c1
Sequence:CCGGGAATTGCGTTTGTTGCCATAACTCGAGTTATGGCAACAAACGCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017824
MARCH5 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-921s21c1
Sequence:CCGGGCCAATCCTTTAGCAGATCATCTCGAGATGATCTGCTAAAGGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-827s21c1
Sequence:CCGGGCTTAGACTGTGGCGCAAATACTCGAGTATTTGCGCCACAGTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-881s1c1
Sequence:CCGGGCCAATCCTTTAGCAGATCATCTCGAGATGATCTGCTAAAGGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-787s1c1
Sequence:CCGGGCTTAGACTGTGGCGCAAATACTCGAGTATTTGCGCCACAGTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-1017s1c1
Sequence:CCGGGAATTGCGTTTGTTGCCATAACTCGAGTTATGGCAACAAACGCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-533s1c1
Sequence:CCGGCCAGTGGTTTACGTCTTGGATCTCGAGATCCAAGACGTAAACCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-325s1c1
Sequence:CCGGCAGAAGTTGCTGGGTTTGTTTCTCGAGAAACAAACCCAGCAACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-573s21c1
Sequence:CCGGCCAGTGGTTTACGTCTTGGATCTCGAGATCCAAGACGTAAACCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-365s21c1
Sequence:CCGGCAGAAGTTGCTGGGTTTGTTTCTCGAGAAACAAACCCAGCAACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-1057s21c1
Sequence:CCGGGAATTGCGTTTGTTGCCATAACTCGAGTTATGGCAACAAACGCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017824
MARCH5 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-921s21c1
Sequence:CCGGGCCAATCCTTTAGCAGATCATCTCGAGATGATCTGCTAAAGGATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-827s21c1
Sequence:CCGGGCTTAGACTGTGGCGCAAATACTCGAGTATTTGCGCCACAGTCTAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-881s1c1
Sequence:CCGGGCCAATCCTTTAGCAGATCATCTCGAGATGATCTGCTAAAGGATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-787s1c1
Sequence:CCGGGCTTAGACTGTGGCGCAAATACTCGAGTATTTGCGCCACAGTCTAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-1017s1c1
Sequence:CCGGGAATTGCGTTTGTTGCCATAACTCGAGTTATGGCAACAAACGCAATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-533s1c1
Sequence:CCGGCCAGTGGTTTACGTCTTGGATCTCGAGATCCAAGACGTAAACCACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017824.2-325s1c1
Sequence:CCGGCAGAAGTTGCTGGGTTTGTTTCTCGAGAAACAAACCCAGCAACTTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-573s21c1
Sequence:CCGGCCAGTGGTTTACGTCTTGGATCTCGAGATCCAAGACGTAAACCACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-365s21c1
Sequence:CCGGCAGAAGTTGCTGGGTTTGTTTCTCGAGAAACAAACCCAGCAACTTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017824.4-1057s21c1
Sequence:CCGGGAATTGCGTTTGTTGCCATAACTCGAGTTATGGCAACAAACGCAATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027314
VALIDATED
MARCH5 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027314.2-657s21c1
Sequence:CCGGACGTCTCTGCTACCAGAATTTCTCGAGAAATTCTGGTAGCAGAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027314.2-867s21c1
Sequence:CCGGCAGAGCAAGAAGAAGCATAAACTCGAGTTTATGCTTCTTCTTGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027314.2-282s21c1
Sequence:CCGGAGCTGGGTCCAGTGGTTTATGCTCGAGCATAAACCACTGGACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027314.2-1323s21c1
Sequence:CCGGGTTAACAGGAGGAAGTGTAAACTCGAGTTTACACTTCCTCCTGTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027314.2-809s1c1
Sequence:CCGGGTTTACTTCAAACAGCAGCAACTCGAGTTGCTGCTGTTTGAAGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027314.2-544s1c1
Sequence:CCGGGCTTAGACTATGGCGCAAATACTCGAGTATTTGCGCCATAGTCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027314.2-404s1c1
Sequence:CCGGGTGACAGTGATGCAGGTTGTACTCGAGTACAACCTGCATCACTGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027314
VALIDATED
MARCH5 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027314.2-657s21c1
Sequence:CCGGACGTCTCTGCTACCAGAATTTCTCGAGAAATTCTGGTAGCAGAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027314.2-867s21c1
Sequence:CCGGCAGAGCAAGAAGAAGCATAAACTCGAGTTTATGCTTCTTCTTGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027314.2-282s21c1
Sequence:CCGGAGCTGGGTCCAGTGGTTTATGCTCGAGCATAAACCACTGGACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027314.2-1323s21c1
Sequence:CCGGGTTAACAGGAGGAAGTGTAAACTCGAGTTTACACTTCCTCCTGTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027314.2-809s1c1
Sequence:CCGGGTTTACTTCAAACAGCAGCAACTCGAGTTGCTGCTGTTTGAAGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027314.2-544s1c1
Sequence:CCGGGCTTAGACTATGGCGCAAATACTCGAGTATTTGCGCCATAGTCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027314.2-404s1c1
Sequence:CCGGGTGACAGTGATGCAGGTTGTACTCGAGTACAACCTGCATCACTGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027314
VALIDATED
MARCH5 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027314.2-657s21c1
Sequence:CCGGACGTCTCTGCTACCAGAATTTCTCGAGAAATTCTGGTAGCAGAGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027314.2-867s21c1
Sequence:CCGGCAGAGCAAGAAGAAGCATAAACTCGAGTTTATGCTTCTTCTTGCTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027314.2-282s21c1
Sequence:CCGGAGCTGGGTCCAGTGGTTTATGCTCGAGCATAAACCACTGGACCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027314.2-1323s21c1
Sequence:CCGGGTTAACAGGAGGAAGTGTAAACTCGAGTTTACACTTCCTCCTGTTAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027314.2-809s1c1
Sequence:CCGGGTTTACTTCAAACAGCAGCAACTCGAGTTGCTGCTGTTTGAAGTAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027314.2-544s1c1
Sequence:CCGGGCTTAGACTATGGCGCAAATACTCGAGTATTTGCGCCATAGTCTAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027314.2-404s1c1
Sequence:CCGGGTGACAGTGATGCAGGTTGTACTCGAGTACAACCTGCATCACTGTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)