EMAIL THIS PAGE TO A FRIEND

MARCH6

membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase

104 Gene Product Result for
Synonyms: DOA10 MARCH-VI RNF176 TEB4
Gene ID:
Human(10299) Summary: This gene encodes a member of a family of membrane-associated E3 ubiquitin ligases containing RING-CH-type zinc finger motifs. Ubiquitination of type II deiodinase by the encoded protein is an important regulatory step in thyroid hormone signalling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(223455) membrane-associated ring finger (C3HC4) 6
Rat(294862) membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
Zebrafish(100002072) membrane-associated ring finger (C3HC4) 6
domestic cat(101092915) membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
cow(540371) membrane-associated ring finger (C3HC4) 6
dog(478617) membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
chicken(420927) membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
domestic guinea pig(100716981) membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
naked mole-rat(101724762) membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
sheep(101105688) membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005885 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005885 Rosetta Predictions human pricing
XM_001065952 Rosetta Predictions rat pricing
XM_215517 Rosetta Predictions rat pricing
NM_172606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105237 predicted 2225
2 SASI_Hs01_00105238 predicted 2708
3 SASI_Hs02_00340481 predicted 1303
4 SASI_Hs02_00340482 predicted 1357
5 SASI_Hs01_00105242 predicted 2821
6 SASI_Hs01_00105243 predicted 1438
7 SASI_Hs01_00105244 predicted 1858
8 SASI_Hs01_00105245 predicted 1939
9 SASI_Hs01_00105246 predicted 2567
10 SASI_Hs02_00340483 predicted 433
11 SASI_Hs01_00105239 predicted 523
12 SASI_Hs01_00105240 predicted 416
13 SASI_Hs01_00105241 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315859 predicted 742
2 SASI_Rn02_00315860 predicted 625
3 SASI_Rn02_00315861 predicted 1175
4 SASI_Rn02_00315862 predicted 2146
5 SASI_Rn02_00315863 predicted 1437
6 SASI_Rn02_00315864 predicted 1246
7 SASI_Rn02_00315865 predicted 1956
8 SASI_Rn02_00315866 predicted 1029
9 SASI_Rn02_00315867 predicted 1446
10 SASI_Rn02_00315868 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376055 predicted 751
2 SASI_Rn02_00376056 predicted 623
3 SASI_Rn02_00376057 predicted 1176
4 SASI_Rn02_00376058 predicted 2147
5 SASI_Rn02_00376059 predicted 1437
6 SASI_Rn02_00376060 predicted 1250
7 SASI_Rn02_00376061 predicted 1963
8 SASI_Rn02_00376062 predicted 1033
9 SASI_Rn02_00376063 predicted 1444
10 SASI_Rn02_00376064 predicted 1415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147482 predicted 1952
2 SASI_Mm01_00147483 predicted 441
3 SASI_Mm01_00147484 predicted 552
4 SASI_Mm01_00147485 predicted 341
5 SASI_Mm01_00147486 predicted 1242
6 SASI_Mm01_00147487 predicted 426
7 SASI_Mm02_00344305 predicted 3016
8 SASI_Mm01_00147488 predicted 856
9 SASI_Mm01_00147489 predicted 1759
10 SASI_Mm01_00147490 predicted 1880
11 SASI_Mm01_00147491 predicted 1216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172606
VALIDATED
MARCH6 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-1218s21c1
Sequence:CCGGCACAACGATTGTTGGATATATCTCGAGATATATCCAACAATCGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172606.1-1318s1c1
Sequence:CCGGGCGTCTGCTATATTGTGGTTACTCGAGTAACCACAATATAGCAGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172606.1-986s1c1
Sequence:CCGGCGACATGAACTGGAATGCTTTCTCGAGAAAGCATTCCAGTTCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-1566s21c1
Sequence:CCGGCTTATGGTTTCTGAGGAATTTCTCGAGAAATTCCTCAGAAACCATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172606.1-1568s1c1
Sequence:CCGGCTTATGGTTTCTGAGGAATTTCTCGAGAAATTCCTCAGAAACCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-984s21c1
Sequence:CCGGCGACATGAACTGGAATGCTTTCTCGAGAAAGCATTCCAGTTCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-1316s21c1
Sequence:CCGGGCGTCTGCTATATTGTGGTTACTCGAGTAACCACAATATAGCAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172606.1-1633s1c1
Sequence:CCGGCCATTTATAGACATCTCCGAACTCGAGTTCGGAGATGTCTATAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172606.2-3024s21c1
Sequence:CCGGCTGTGATCTCAGCGTTGTTTACTCGAGTAAACAACGCTGAGATCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172606
VALIDATED
MARCH6 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-1218s21c1
Sequence:CCGGCACAACGATTGTTGGATATATCTCGAGATATATCCAACAATCGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172606.1-1318s1c1
Sequence:CCGGGCGTCTGCTATATTGTGGTTACTCGAGTAACCACAATATAGCAGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172606.1-986s1c1
Sequence:CCGGCGACATGAACTGGAATGCTTTCTCGAGAAAGCATTCCAGTTCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-1566s21c1
Sequence:CCGGCTTATGGTTTCTGAGGAATTTCTCGAGAAATTCCTCAGAAACCATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172606.1-1568s1c1
Sequence:CCGGCTTATGGTTTCTGAGGAATTTCTCGAGAAATTCCTCAGAAACCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-984s21c1
Sequence:CCGGCGACATGAACTGGAATGCTTTCTCGAGAAAGCATTCCAGTTCATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-1316s21c1
Sequence:CCGGGCGTCTGCTATATTGTGGTTACTCGAGTAACCACAATATAGCAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172606.1-1633s1c1
Sequence:CCGGCCATTTATAGACATCTCCGAACTCGAGTTCGGAGATGTCTATAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172606.2-3024s21c1
Sequence:CCGGCTGTGATCTCAGCGTTGTTTACTCGAGTAAACAACGCTGAGATCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172606
VALIDATED
MARCH6 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-1218s21c1
Sequence:CCGGCACAACGATTGTTGGATATATCTCGAGATATATCCAACAATCGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172606.1-1318s1c1
Sequence:CCGGGCGTCTGCTATATTGTGGTTACTCGAGTAACCACAATATAGCAGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172606.1-986s1c1
Sequence:CCGGCGACATGAACTGGAATGCTTTCTCGAGAAAGCATTCCAGTTCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-1566s21c1
Sequence:CCGGCTTATGGTTTCTGAGGAATTTCTCGAGAAATTCCTCAGAAACCATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172606.1-1568s1c1
Sequence:CCGGCTTATGGTTTCTGAGGAATTTCTCGAGAAATTCCTCAGAAACCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-984s21c1
Sequence:CCGGCGACATGAACTGGAATGCTTTCTCGAGAAAGCATTCCAGTTCATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172606.2-1316s21c1
Sequence:CCGGGCGTCTGCTATATTGTGGTTACTCGAGTAACCACAATATAGCAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172606.1-1633s1c1
Sequence:CCGGCCATTTATAGACATCTCCGAACTCGAGTTCGGAGATGTCTATAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172606.2-3024s21c1
Sequence:CCGGCTGTGATCTCAGCGTTGTTTACTCGAGTAAACAACGCTGAGATCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005885
VALIDATED
MARCH6 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005885.2-3339s1c1
Sequence:CCGGGCTCTCACTAAGGGAACTGTACTCGAGTACAGTTCCCTTAGTGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005885.2-3751s1c1
Sequence:CCGGCCACACACAACTATCTGTTTACTCGAGTAAACAGATAGTTGTGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005885.2-520s1c1
Sequence:CCGGCGCATCTACAAGTGCTTGTTTCTCGAGAAACAAGCACTTGTAGATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005885.2-1944s21c1
Sequence:CCGGTAATCAGCATGCTCGAAATAACTCGAGTTATTTCGAGCATGCTGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005885.2-3384s21c1
Sequence:CCGGGACCTTACCAAGAACGTTAAACTCGAGTTTAACGTTCTTGGTAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005885.2-1186s21c1
Sequence:CCGGACAACCATAGTTGGGTATATACTCGAGTATATACCCAACTATGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005885.2-697s1c1
Sequence:CCGGGCACCAATTTGGTTGGAGCATCTCGAGATGCTCCAACCAAATTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005885.2-2713s21c1
Sequence:CCGGTTAGTCCATCGGCGGATTTATCTCGAGATAAATCCGCCGATGGACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005885.2-3059s1c1
Sequence:CCGGGCGGTGTAAGATTCTGCTGTTCTCGAGAACAGCAGAATCTTACACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005885.2-946s1c1
Sequence:CCGGCAGGATGACATGAATTGGAATCTCGAGATTCCAATTCATGTCATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005885.2-1585s21c1
Sequence:CCGGATGATCCATTTGCCAATATATCTCGAGATATATTGGCAAATGGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005885
VALIDATED
MARCH6 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005885.2-3339s1c1
Sequence:CCGGGCTCTCACTAAGGGAACTGTACTCGAGTACAGTTCCCTTAGTGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005885.2-3751s1c1
Sequence:CCGGCCACACACAACTATCTGTTTACTCGAGTAAACAGATAGTTGTGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005885.2-520s1c1
Sequence:CCGGCGCATCTACAAGTGCTTGTTTCTCGAGAAACAAGCACTTGTAGATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005885.2-1944s21c1
Sequence:CCGGTAATCAGCATGCTCGAAATAACTCGAGTTATTTCGAGCATGCTGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005885.2-3384s21c1
Sequence:CCGGGACCTTACCAAGAACGTTAAACTCGAGTTTAACGTTCTTGGTAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005885.2-1186s21c1
Sequence:CCGGACAACCATAGTTGGGTATATACTCGAGTATATACCCAACTATGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005885.2-697s1c1
Sequence:CCGGGCACCAATTTGGTTGGAGCATCTCGAGATGCTCCAACCAAATTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005885.2-2713s21c1
Sequence:CCGGTTAGTCCATCGGCGGATTTATCTCGAGATAAATCCGCCGATGGACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005885.2-3059s1c1
Sequence:CCGGGCGGTGTAAGATTCTGCTGTTCTCGAGAACAGCAGAATCTTACACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005885.2-946s1c1
Sequence:CCGGCAGGATGACATGAATTGGAATCTCGAGATTCCAATTCATGTCATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005885.2-1585s21c1
Sequence:CCGGATGATCCATTTGCCAATATATCTCGAGATATATTGGCAAATGGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005885
VALIDATED
MARCH6 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005885.2-3339s1c1
Sequence:CCGGGCTCTCACTAAGGGAACTGTACTCGAGTACAGTTCCCTTAGTGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005885.2-3751s1c1
Sequence:CCGGCCACACACAACTATCTGTTTACTCGAGTAAACAGATAGTTGTGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005885.2-520s1c1
Sequence:CCGGCGCATCTACAAGTGCTTGTTTCTCGAGAAACAAGCACTTGTAGATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005885.2-1944s21c1
Sequence:CCGGTAATCAGCATGCTCGAAATAACTCGAGTTATTTCGAGCATGCTGATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005885.2-3384s21c1
Sequence:CCGGGACCTTACCAAGAACGTTAAACTCGAGTTTAACGTTCTTGGTAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005885.2-1186s21c1
Sequence:CCGGACAACCATAGTTGGGTATATACTCGAGTATATACCCAACTATGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005885.2-697s1c1
Sequence:CCGGGCACCAATTTGGTTGGAGCATCTCGAGATGCTCCAACCAAATTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005885.2-2713s21c1
Sequence:CCGGTTAGTCCATCGGCGGATTTATCTCGAGATAAATCCGCCGATGGACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005885.2-3059s1c1
Sequence:CCGGGCGGTGTAAGATTCTGCTGTTCTCGAGAACAGCAGAATCTTACACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005885.2-946s1c1
Sequence:CCGGCAGGATGACATGAATTGGAATCTCGAGATTCCAATTCATGTCATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005885.2-1585s21c1
Sequence:CCGGATGATCCATTTGCCAATATATCTCGAGATATATTGGCAAATGGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)