EMAIL THIS PAGE TO A FRIEND

MARCH7

membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase

245 Gene Product Result for
Synonyms: AXO AXOT MARCH-VII RNF177
UniProtKB ID: Q9H992, A8K9X1, D3DPB0, Q53GQ1, Q9BTR9
Gene ID:
Human(64844) Summary: MARCH7 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Bartee et al., 2004 [PubMed 14722266]
Mouse(57438) membrane-associated ring finger (C3HC4) 7
Rat(311059) membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
sheep(101110480) membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
naked mole-rat(101704599) membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
Domestic Rabbit(100357576) membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
domestic guinea pig(100723317) membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
Zebrafish(100136862) membrane-associated ring finger (C3HC4) 7
cow(507865) membrane-associated ring finger (C3HC4) 7
Horse(100051194) membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
chicken(424332) membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
domestic cat(101093628) membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
dog(478763) membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022826 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022826 Rosetta Predictions human pricing
NM_001012087 Rosetta Predictions rat pricing
XM_575138 Rosetta Predictions rat pricing
NM_020575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356126 predicted 298
2 SASI_Hs01_00173727 predicted 1400
3 SASI_Hs01_00173728 predicted 1802
4 SASI_Hs01_00173729 predicted 1980
5 SASI_Hs01_00173731 predicted 1922
6 SASI_Hs01_00173732 predicted 1630
7 SASI_Hs01_00173733 predicted 1357
8 SASI_Hs01_00173734 predicted 309
9 SASI_Hs01_00173735 predicted 1285
10 SASI_Hs02_00356127 predicted 1816
11 SASI_Hs01_00173726 predicted 231
12 SASI_Hs01_00173730 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049144 predicted 1690
2 SASI_Rn01_00049145 predicted 1084
3 SASI_Rn01_00049146 predicted 1683
4 SASI_Rn01_00049147 predicted 2057
5 SASI_Rn01_00049148 predicted 1307
6 SASI_Rn01_00049149 predicted 2110
7 SASI_Rn01_00049150 predicted 361
8 SASI_Rn01_00049151 predicted 1145
9 SASI_Rn01_00049152 predicted 1785
10 SASI_Rn01_00049153 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177023 predicted 1963
2 SASI_Rn01_00177024 predicted 1347
3 SASI_Rn01_00177025 predicted 1948
4 SASI_Rn01_00177026 predicted 2326
5 SASI_Rn01_00177027 predicted 1575
6 SASI_Rn01_00177028 predicted 2378
7 SASI_Rn01_00177029 predicted 1420
8 SASI_Rn01_00177030 predicted 2056
9 SASI_Rn01_00177031 predicted 1270
10 SASI_Rn01_00177032 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037103 predicted 529
2 SASI_Mm01_00037104 predicted 1899
3 SASI_Mm01_00037106 predicted 1964
4 SASI_Mm02_00325639 predicted 961
5 SASI_Mm01_00037107 predicted 2024
6 SASI_Mm01_00037108 predicted 819
7 SASI_Mm02_00325640 predicted 740
8 SASI_Mm01_00037109 predicted 971
9 SASI_Mm01_00037111 predicted 791
10 SASI_Mm01_00037112 predicted 1053
11 SASI_Mm01_00037105 predicted 261
12 SASI_Mm01_00037110 predicted 1680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022826
VALIDATED
MARCH7 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-886s1c2
Sequence:CCGGGCAATTCAGAAAGGGTTGTTTCTCGAGAAACAACCCTTTCTGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022826.2-2436s21c1
Sequence:CCGGACATAGCAAATCCGATGTTTACTCGAGTAAACATCGGATTTGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-2115s21c1
Sequence:CCGGAGCACACGTGTCCGATTTATTCTCGAGAATAAATCGGACACGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-1119s1c1
Sequence:CCGGGCTTCTGAAGTTCCCGATAATCTCGAGATTATCGGGAACTTCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022826.1-2204s1c1
Sequence:CCGGCGGAGACCATAACAGGACATTCTCGAGAATGTCCTGTTATGGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-2121s1c1
Sequence:CCGGCGTGTCCGATTTATTAACCTTCTCGAGAAGGTTAATAAATCGGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-1560s1c2
Sequence:CCGGCCTGGTTCCTTATTCCGGTTTCTCGAGAAACCGGAATAAGGAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-1589s21c1
Sequence:CCGGTCCAGCACTTGGGAGTAATTTCTCGAGAAATTACTCCCAAGTGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022826.2-570s21c1
Sequence:CCGGACAGATTCCTCTATTAGTAATCTCGAGATTACTAATAGAGGAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-507s21c1
Sequence:CCGGTCAATGGTACTTGGATCATTTCTCGAGAAATGATCCAAGTACCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022826.2-2645s21c1
Sequence:CCGGATGCTATATGGCACCTAATTACTCGAGTAATTAGGTGCCATATAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022826.2-1622s21c1
Sequence:CCGGCATGATCACAGTAGATATTATCTCGAGATAATATCTACTGTGATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-1089s21c1
Sequence:CCGGGCTTCACAGTCCCGTAGTAATCTCGAGATTACTACGGGACTGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022826
VALIDATED
MARCH7 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-886s1c2
Sequence:CCGGGCAATTCAGAAAGGGTTGTTTCTCGAGAAACAACCCTTTCTGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022826.2-2436s21c1
Sequence:CCGGACATAGCAAATCCGATGTTTACTCGAGTAAACATCGGATTTGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-2115s21c1
Sequence:CCGGAGCACACGTGTCCGATTTATTCTCGAGAATAAATCGGACACGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-1119s1c1
Sequence:CCGGGCTTCTGAAGTTCCCGATAATCTCGAGATTATCGGGAACTTCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022826.1-2204s1c1
Sequence:CCGGCGGAGACCATAACAGGACATTCTCGAGAATGTCCTGTTATGGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-2121s1c1
Sequence:CCGGCGTGTCCGATTTATTAACCTTCTCGAGAAGGTTAATAAATCGGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-1560s1c2
Sequence:CCGGCCTGGTTCCTTATTCCGGTTTCTCGAGAAACCGGAATAAGGAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-1589s21c1
Sequence:CCGGTCCAGCACTTGGGAGTAATTTCTCGAGAAATTACTCCCAAGTGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022826.2-570s21c1
Sequence:CCGGACAGATTCCTCTATTAGTAATCTCGAGATTACTAATAGAGGAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-507s21c1
Sequence:CCGGTCAATGGTACTTGGATCATTTCTCGAGAAATGATCCAAGTACCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022826.2-2645s21c1
Sequence:CCGGATGCTATATGGCACCTAATTACTCGAGTAATTAGGTGCCATATAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022826.2-1622s21c1
Sequence:CCGGCATGATCACAGTAGATATTATCTCGAGATAATATCTACTGTGATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-1089s21c1
Sequence:CCGGGCTTCACAGTCCCGTAGTAATCTCGAGATTACTACGGGACTGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022826
VALIDATED
MARCH7 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-886s1c2
Sequence:CCGGGCAATTCAGAAAGGGTTGTTTCTCGAGAAACAACCCTTTCTGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022826.2-2436s21c1
Sequence:CCGGACATAGCAAATCCGATGTTTACTCGAGTAAACATCGGATTTGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-2115s21c1
Sequence:CCGGAGCACACGTGTCCGATTTATTCTCGAGAATAAATCGGACACGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-1119s1c1
Sequence:CCGGGCTTCTGAAGTTCCCGATAATCTCGAGATTATCGGGAACTTCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022826.1-2204s1c1
Sequence:CCGGCGGAGACCATAACAGGACATTCTCGAGAATGTCCTGTTATGGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-2121s1c1
Sequence:CCGGCGTGTCCGATTTATTAACCTTCTCGAGAAGGTTAATAAATCGGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022826.1-1560s1c2
Sequence:CCGGCCTGGTTCCTTATTCCGGTTTCTCGAGAAACCGGAATAAGGAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-1589s21c1
Sequence:CCGGTCCAGCACTTGGGAGTAATTTCTCGAGAAATTACTCCCAAGTGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022826.2-570s21c1
Sequence:CCGGACAGATTCCTCTATTAGTAATCTCGAGATTACTAATAGAGGAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-507s21c1
Sequence:CCGGTCAATGGTACTTGGATCATTTCTCGAGAAATGATCCAAGTACCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022826.2-2645s21c1
Sequence:CCGGATGCTATATGGCACCTAATTACTCGAGTAATTAGGTGCCATATAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022826.2-1622s21c1
Sequence:CCGGCATGATCACAGTAGATATTATCTCGAGATAATATCTACTGTGATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022826.2-1089s21c1
Sequence:CCGGGCTTCACAGTCCCGTAGTAATCTCGAGATTACTACGGGACTGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020575
MARCH7 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-1405s1c1
Sequence:CCGGCGTCAGATGTACCACCTAGATCTCGAGATCTAGGTGGTACATCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020575.1-2256s1c1
Sequence:CCGGCCATAAGAGAATGCTTGATATCTCGAGATATCAAGCATTCTCTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020575.2-2609s21c1
Sequence:CCGGGCAATTACTGTAGTCATATTTCTCGAGAAATATGACTACAGTAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-969s1c1
Sequence:CCGGCGAGAATCTTCTGACAATGAACTCGAGTTCATTGTCAGAAGATTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-2000s1c1
Sequence:CCGGGCAACTTAACCTGGAGGATTTCTCGAGAAATCCTCCAGGTTAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-282s1c1
Sequence:CCGGGACTCCTCCTTTAGACTGGATCTCGAGATCCAGTCTAAAGGAGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020575
MARCH7 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-1405s1c1
Sequence:CCGGCGTCAGATGTACCACCTAGATCTCGAGATCTAGGTGGTACATCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020575.1-2256s1c1
Sequence:CCGGCCATAAGAGAATGCTTGATATCTCGAGATATCAAGCATTCTCTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020575.2-2609s21c1
Sequence:CCGGGCAATTACTGTAGTCATATTTCTCGAGAAATATGACTACAGTAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-969s1c1
Sequence:CCGGCGAGAATCTTCTGACAATGAACTCGAGTTCATTGTCAGAAGATTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-2000s1c1
Sequence:CCGGGCAACTTAACCTGGAGGATTTCTCGAGAAATCCTCCAGGTTAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-282s1c1
Sequence:CCGGGACTCCTCCTTTAGACTGGATCTCGAGATCCAGTCTAAAGGAGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020575
MARCH7 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-1405s1c1
Sequence:CCGGCGTCAGATGTACCACCTAGATCTCGAGATCTAGGTGGTACATCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020575.1-2256s1c1
Sequence:CCGGCCATAAGAGAATGCTTGATATCTCGAGATATCAAGCATTCTCTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020575.2-2609s21c1
Sequence:CCGGGCAATTACTGTAGTCATATTTCTCGAGAAATATGACTACAGTAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-969s1c1
Sequence:CCGGCGAGAATCTTCTGACAATGAACTCGAGTTCATTGTCAGAAGATTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-2000s1c1
Sequence:CCGGGCAACTTAACCTGGAGGATTTCTCGAGAAATCCTCCAGGTTAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020575.1-282s1c1
Sequence:CCGGGACTCCTCCTTTAGACTGGATCTCGAGATCCAGTCTAAAGGAGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)