EMAIL THIS PAGE TO A FRIEND

MARCH8

membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase

76 Gene Product Result for
Synonyms: MARCH-VIII MIR RNF178 c-MIR
UniProtKB ID: Q5T0T0, B2R8E7, Q5T0S8, Q8TC72
Gene ID:
Human(220972) Summary: MARCH8 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH8 induces the internalization of several membrane glycoproteins (Goto et al., 2003 [PubMed 12582153]
Mouse(71779) membrane-associated ring finger (C3HC4) 8
Rat(312656) membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
Zebrafish(567818) membrane-associated ring finger (C3HC4) 8
cow(540667) membrane-associated ring finger (C3HC4) 8
Horse(100062110) membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
domestic cat(101097021) membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
dog(606989) membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
chicken(423770) membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
domestic guinea pig(100718377) membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
naked mole-rat(101701304) membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
sheep(101120136) membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145021 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002265 Rosetta Predictions human pricing
NM_001002266 Rosetta Predictions human pricing
NM_145021 Rosetta Predictions human pricing
NM_001107882 Rosetta Predictions rat pricing
NM_027920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064950 predicted 1705
2 SASI_Hs01_00064951 predicted 1710
3 SASI_Hs01_00064952 predicted 1532
4 SASI_Hs01_00064953 predicted 1533
5 SASI_Hs01_00064954 predicted 1352
6 SASI_Hs01_00064955 predicted 1216
7 SASI_Hs01_00064956 predicted 1526
8 SASI_Hs01_00064957 predicted 1501
9 SASI_Hs01_00064958 predicted 1655
10 SASI_Hs01_00064959 predicted 1715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011066 predicted 1101
2 SASI_Hs01_00011067 predicted 1109
3 SASI_Hs01_00011068 predicted 925
4 SASI_Hs01_00011069 predicted 928
5 SASI_Hs01_00011070 predicted 753
6 SASI_Hs01_00011071 predicted 615
7 SASI_Hs01_00011072 predicted 927
8 SASI_Hs01_00011073 predicted 896
9 SASI_Hs01_00011074 predicted 1046
10 SASI_Hs01_00011075 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115679 predicted 1618
2 SASI_Hs01_00115680 predicted 1614
3 SASI_Hs01_00115681 predicted 1437
4 SASI_Hs01_00115682 predicted 1433
5 SASI_Hs01_00115683 predicted 1264
6 SASI_Hs01_00115684 predicted 1126
7 SASI_Hs01_00115685 predicted 1438
8 SASI_Hs01_00115686 predicted 1401
9 SASI_Hs01_00115687 predicted 1560
10 SASI_Hs01_00115688 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233205 predicted 1158
2 SASI_Rn02_00233206 predicted 1142
3 SASI_Rn02_00233207 predicted 406
4 SASI_Rn02_00233208 predicted 936
5 SASI_Rn02_00233209 predicted 1004
6 SASI_Rn02_00233210 predicted 854
7 SASI_Rn02_00233211 predicted 728
8 SASI_Rn02_00233212 predicted 374
9 SASI_Rn02_00233213 predicted 765
10 SASI_Rn02_00233214 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164996 predicted 1229
2 SASI_Mm01_00164997 predicted 1120
3 SASI_Mm02_00332899 predicted 836
4 SASI_Mm01_00164998 predicted 1133
5 SASI_Mm01_00164999 predicted 506
6 SASI_Mm01_00165000 predicted 1342
7 SASI_Mm01_00165001 predicted 1093
8 SASI_Mm01_00165002 predicted 844
9 SASI_Mm02_00332900 predicted 457
10 SASI_Mm01_00165003 predicted 1237
11 SASI_Mm01_00164995 predicted 1248
12 SASI_Mm01_00165004 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145021
VALIDATED
MARCH8 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073236    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-749s1c1
Sequence:CCGGCTGGTCCTTGTATGTGCTCATCTCGAGATGAGCACATACAAGGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073235    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-891s1c1
Sequence:CCGGCAGTGTAAAGTGTATGTGCAACTCGAGTTGCACATACACTTTACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073237    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-433s1c1
Sequence:CCGGCCTCCTTCTCTCGCACTTCTACTCGAGTAGAAGTGCGAGAGAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073234    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-999s1c1
Sequence:CCGGCCACTAACAGAGCCCAACTTTCTCGAGAAAGTTGGGCTCTGTTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073233    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-1390s1c1
Sequence:CCGGCTTGAGCTGAATGAGAGAATACTCGAGTATTCTCTCATTCAGCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145021.4-1724s21c1
Sequence:CCGGGACTGGACAGGTGACTATTTACTCGAGTAAATAGTCACCTGTCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145021.4-855s21c1
Sequence:CCGGTGAGAAGACTTTGGGACATTTCTCGAGAAATGTCCCAAAGTCTTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145021.4-878s21c1
Sequence:CCGGTGAGTCATTCAAGCAACATTTCTCGAGAAATGTTGCTTGAATGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145021
VALIDATED
MARCH8 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073236    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-749s1c1
Sequence:CCGGCTGGTCCTTGTATGTGCTCATCTCGAGATGAGCACATACAAGGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073235    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-891s1c1
Sequence:CCGGCAGTGTAAAGTGTATGTGCAACTCGAGTTGCACATACACTTTACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073237    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-433s1c1
Sequence:CCGGCCTCCTTCTCTCGCACTTCTACTCGAGTAGAAGTGCGAGAGAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073234    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-999s1c1
Sequence:CCGGCCACTAACAGAGCCCAACTTTCTCGAGAAAGTTGGGCTCTGTTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073233    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-1390s1c1
Sequence:CCGGCTTGAGCTGAATGAGAGAATACTCGAGTATTCTCTCATTCAGCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145021.4-1724s21c1
Sequence:CCGGGACTGGACAGGTGACTATTTACTCGAGTAAATAGTCACCTGTCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145021.4-855s21c1
Sequence:CCGGTGAGAAGACTTTGGGACATTTCTCGAGAAATGTCCCAAAGTCTTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145021.4-878s21c1
Sequence:CCGGTGAGTCATTCAAGCAACATTTCTCGAGAAATGTTGCTTGAATGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145021
VALIDATED
MARCH8 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073236    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-749s1c1
Sequence:CCGGCTGGTCCTTGTATGTGCTCATCTCGAGATGAGCACATACAAGGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073235    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-891s1c1
Sequence:CCGGCAGTGTAAAGTGTATGTGCAACTCGAGTTGCACATACACTTTACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073237    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-433s1c1
Sequence:CCGGCCTCCTTCTCTCGCACTTCTACTCGAGTAGAAGTGCGAGAGAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073234    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-999s1c1
Sequence:CCGGCCACTAACAGAGCCCAACTTTCTCGAGAAAGTTGGGCTCTGTTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073233    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_145021.2-1390s1c1
Sequence:CCGGCTTGAGCTGAATGAGAGAATACTCGAGTATTCTCTCATTCAGCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145021.4-1724s21c1
Sequence:CCGGGACTGGACAGGTGACTATTTACTCGAGTAAATAGTCACCTGTCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145021.4-855s21c1
Sequence:CCGGTGAGAAGACTTTGGGACATTTCTCGAGAAATGTCCCAAAGTCTTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145021.4-878s21c1
Sequence:CCGGTGAGTCATTCAAGCAACATTTCTCGAGAAATGTTGCTTGAATGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027920
MARCH8 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027920.3-3318s1c1
Sequence:CCGGCCCACATAGATAGGTGGCTTTCTCGAGAAAGCCACCTATCTATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-1090s1c1
Sequence:CCGGGCAAGGTGTACCTACAGTTATCTCGAGATAACTGTAGGTACACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-641s1c1
Sequence:CCGGCACTTCTGTCACACCATCCAACTCGAGTTGGATGGTGTGACAGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-562s1c1
Sequence:CCGGCCATGAGTCATCCAAGCAACACTCGAGTGTTGCTTGGATGACTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-1089s1c1
Sequence:CCGGTGCAAGGTGTACCTACAGTTACTCGAGTAACTGTAGGTACACCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027920
MARCH8 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027920.3-3318s1c1
Sequence:CCGGCCCACATAGATAGGTGGCTTTCTCGAGAAAGCCACCTATCTATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-1090s1c1
Sequence:CCGGGCAAGGTGTACCTACAGTTATCTCGAGATAACTGTAGGTACACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-641s1c1
Sequence:CCGGCACTTCTGTCACACCATCCAACTCGAGTTGGATGGTGTGACAGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-562s1c1
Sequence:CCGGCCATGAGTCATCCAAGCAACACTCGAGTGTTGCTTGGATGACTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-1089s1c1
Sequence:CCGGTGCAAGGTGTACCTACAGTTACTCGAGTAACTGTAGGTACACCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027920
MARCH8 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027920.3-3318s1c1
Sequence:CCGGCCCACATAGATAGGTGGCTTTCTCGAGAAAGCCACCTATCTATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-1090s1c1
Sequence:CCGGGCAAGGTGTACCTACAGTTATCTCGAGATAACTGTAGGTACACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-641s1c1
Sequence:CCGGCACTTCTGTCACACCATCCAACTCGAGTTGGATGGTGTGACAGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-562s1c1
Sequence:CCGGCCATGAGTCATCCAAGCAACACTCGAGTGTTGCTTGGATGACTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027920.3-1089s1c1
Sequence:CCGGTGCAAGGTGTACCTACAGTTACTCGAGTAACTGTAGGTACACCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)